Construct: ORF TRCN0000478966
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004994.1_s317c1
- Derived from:
- ccsbBroadEn_16008
- DNA Barcode:
- GTGCCATGCGGCGACGTTTAAGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXO38 (81545)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000478966
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 81545 | FBXO38 | F-box protein 38 | XM_011537684.3 | 54% | 54% | 1_1086del |
2 | human | 81545 | FBXO38 | F-box protein 38 | XM_017009900.2 | 54% | 54% | 1_1086del |
3 | human | 81545 | FBXO38 | F-box protein 38 | XM_017009899.1 | 51.8% | 51.8% | 1_1188del |
4 | human | 81545 | FBXO38 | F-box protein 38 | XM_017009902.2 | 44.5% | 44.5% | 1_1086del;1227_1228ins225 |
5 | human | 81545 | FBXO38 | F-box protein 38 | XM_017009901.2 | 42.7% | 42.7% | 1_1188del;1329_1330ins225 |
6 | human | 81545 | FBXO38 | F-box protein 38 | NM_001271723.1 | 40.1% | 34% | (many diffs) |
7 | human | 81545 | FBXO38 | F-box protein 38 | NM_205836.3 | 35.8% | 35.8% | 1_2286del |
8 | human | 81545 | FBXO38 | F-box protein 38 | XM_024446223.1 | 35.8% | 35.8% | 1_2286del |
9 | human | 81545 | FBXO38 | F-box protein 38 | XM_006714797.2 | 32.3% | 32.3% | 1_2286del;2524_2525ins126 |
10 | human | 81545 | FBXO38 | F-box protein 38 | NM_030793.5 | 29.5% | 29.5% | 1_2286del;2427_2428ins225 |
11 | human | 81545 | FBXO38 | F-box protein 38 | XR_001742284.1 | 27.3% | 1_2432del;3002_3003ins74;3637_4328del | |
12 | mouse | 107035 | Fbxo38 | F-box protein 38 | XM_017317781.1 | 49.7% | 52.9% | (many diffs) |
13 | mouse | 107035 | Fbxo38 | F-box protein 38 | XM_017317780.1 | 49.6% | 52.8% | (many diffs) |
14 | mouse | 107035 | Fbxo38 | F-box protein 38 | NM_134136.3 | 32.4% | 34.5% | (many diffs) |
15 | mouse | 107035 | Fbxo38 | F-box protein 38 | XM_006525497.3 | 32.4% | 34.5% | (many diffs) |
16 | mouse | 107035 | Fbxo38 | F-box protein 38 | XM_006525498.1 | 32.4% | 34.5% | (many diffs) |
17 | mouse | 107035 | Fbxo38 | F-box protein 38 | XM_006525499.3 | 32.4% | 34.5% | (many diffs) |
18 | mouse | 107035 | Fbxo38 | F-box protein 38 | XM_006525502.3 | 26.3% | 28.5% | (many diffs) |
19 | mouse | 107035 | Fbxo38 | F-box protein 38 | XM_006525501.3 | 26.3% | 28.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1344
- ORF length:
- 1278
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggagggagat gcagagagtt ctgtctgccc cagatgctgc tgtcacaggc 121 cccaggaatc ccaaaggaga actagcaggt gttctgatga ggaacgtcct tcaaccagcc 181 gagcctgtgt tgtgaatggc ccggatggta cgagatccgc cttttccttt aggactctgc 241 cacaaggggg gtcttcaggc ccagcacatg atgagaggac taatgggagt ggctctgggg 301 ctacaggtga ggacaggagg gggagctccc agcctgagag ttgtgacgtg cagtctaatg 361 aagactaccc tcggaggccc ctaaccaggg ccaggagcag actgtcccat gtactgctgg 421 tatctgagtc agaagtagcc aaaacaaagc cacgtcacgc catgaaacgg aagcggacag 481 cagataaatc cactagtaca agtgatcctg tgatcgagga tgaccatgtg caggttcttg 541 tattaaaatc caagaatctt gttggagtca ctatgaccaa ttgtggaatc acagatctag 601 tgctaaaaga ctgtccaaag atgatgttca tccatgctac caggtgcagg gtactaaaac 661 atttaaaggt agaaaatgca ccaattgtaa accgatttga ctatgcacag tgcaagaaac 721 tgaacatgga tcaggtacta gaccagatac taagaatgcc acccgagaga aaccgcatca 781 tatacctacg cccaatgcag caggtggaca ctctaacttt ggagcagaag ctatttagtg 841 gtccctaccc ctatcacatc tgtattatcc atgaattcag taaccctccc aatgtccgga 901 ataaggtgcg cattcgcagc tggatggaca ctatagcaaa catcaatcaa gagctcatta 961 aatatgaatT CTTCCCTGAA GCCACTCGAA GTGAAGAAGA CTTAAAGAAA TACCCCAAGT 1021 ACCCCTGGGG GAGAGAAATC TATACTTTAG AAGGTGTTGT GGATGGAGCT CCATATTCCA 1081 TGATTTCTGA CTTCCCTTGG CTGAGGTCAT TACGAGCTGC AGAGCCCAAC AGCTTCGCTC 1141 GATACGACTT TGAAGACGAT GAAGAAAGCA CTATCTATGC TCCTAGAAGG AAAGGACAGC 1201 TGTCTGCAGA CATCTGTATG GAAACAATAG GAGAGGAAAT TTCAGAGATG CGTCAGATGA 1261 AGAAGGGTGT ATTTCAGCGA GTAGTGGCAA TTTTTATCCA CTATTGTGAT GTCAATGGAG 1321 AGCCAGTTGA AGATGACTAC ATTTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1381 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1441 TTGAAAGTAT TTCGATTTCT TGGGCTTTAT ATATCTTGTG GAAAGGACGA GTGCCATGCG 1501 GCGACGTTTA AGTCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa 1561 gatt