Transcript: Human NM_030793.5

Homo sapiens F-box protein 38 (FBXO38), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-16
Taxon:
Homo sapiens (human)
Gene:
FBXO38 (81545)
Length:
4176
CDS:
146..3487

Additional Resources:

NCBI RefSeq record:
NM_030793.5
NBCI Gene record:
FBXO38 (81545)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030793.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137857 GCCCGTAGGTTACATGAAGTT pLKO.1 1100 CDS 100% 4.950 6.930 N FBXO38 n/a
2 TRCN0000133912 CAGCTTAAGAACTTTCGTCAT pLKO.1 841 CDS 100% 4.050 5.670 N FBXO38 n/a
3 TRCN0000138200 GAATGTCTTTCCCGGAAGCTA pLKO.1 305 CDS 100% 3.000 4.200 N FBXO38 n/a
4 TRCN0000215399 CATCAATCAAGAGCTCATTAA pLKO.1 3082 CDS 100% 13.200 9.240 N Fbxo38 n/a
5 TRCN0000249721 CATCAATCAAGAGCTCATTAA pLKO_005 3082 CDS 100% 13.200 9.240 N Fbxo38 n/a
6 TRCN0000173406 GCAGATCAAAGCCGATATGAA pLKO.1 2182 CDS 100% 5.625 3.938 N Fbxo38 n/a
7 TRCN0000134610 GACTTCCTTTGTATCAGCTTA pLKO.1 827 CDS 100% 4.950 3.465 N FBXO38 n/a
8 TRCN0000175255 CTGTATCAAATATCTGGCAAT pLKO.1 1345 CDS 100% 4.050 2.835 N Fbxo38 n/a
9 TRCN0000138189 CCAAACTTAGTGGGTGTGGAA pLKO.1 560 CDS 100% 2.640 1.848 N FBXO38 n/a
10 TRCN0000175377 CCTGTATCAAATATCTGGCAA pLKO.1 1344 CDS 100% 2.640 1.848 N Fbxo38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030793.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09069 pDONR223 100% 99.9% 99.9% None 409G>T n/a
2 ccsbBroad304_09069 pLX_304 0% 99.9% 99.9% V5 409G>T n/a
3 ccsbBroadEn_12717 pDONR223 100% 84.7% 84.7% None 1918_2427del n/a
4 ccsbBroad304_12717 pLX_304 0% 84.7% 84.7% V5 1918_2427del n/a
5 TRCN0000471001 CTAGATGGCACTAGGATAACCACC pLX_317 13.5% 84.7% 84.7% V5 1918_2427del n/a
6 ccsbBroadEn_16008 pDONR223 0% 29.5% 29.5% None 1_2286del;2427_2428ins225 n/a
7 ccsbBroad304_16008 pLX_304 0% 29.5% 29.5% V5 1_2286del;2427_2428ins225 n/a
8 TRCN0000478966 GTGCCATGCGGCGACGTTTAAGTC pLX_317 29.6% 29.5% 29.5% V5 1_2286del;2427_2428ins225 n/a
Download CSV