Transcript: Human XM_024446223.1

PREDICTED: Homo sapiens F-box protein 38 (FBXO38), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXO38 (81545)
Length:
5279
CDS:
1024..4590

Additional Resources:

NCBI RefSeq record:
XM_024446223.1
NBCI Gene record:
FBXO38 (81545)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137857 GCCCGTAGGTTACATGAAGTT pLKO.1 1978 CDS 100% 4.950 6.930 N FBXO38 n/a
2 TRCN0000133912 CAGCTTAAGAACTTTCGTCAT pLKO.1 1719 CDS 100% 4.050 5.670 N FBXO38 n/a
3 TRCN0000138200 GAATGTCTTTCCCGGAAGCTA pLKO.1 1183 CDS 100% 3.000 4.200 N FBXO38 n/a
4 TRCN0000215399 CATCAATCAAGAGCTCATTAA pLKO.1 4185 CDS 100% 13.200 9.240 N Fbxo38 n/a
5 TRCN0000249721 CATCAATCAAGAGCTCATTAA pLKO_005 4185 CDS 100% 13.200 9.240 N Fbxo38 n/a
6 TRCN0000173406 GCAGATCAAAGCCGATATGAA pLKO.1 3060 CDS 100% 5.625 3.938 N Fbxo38 n/a
7 TRCN0000134610 GACTTCCTTTGTATCAGCTTA pLKO.1 1705 CDS 100% 4.950 3.465 N FBXO38 n/a
8 TRCN0000175255 CTGTATCAAATATCTGGCAAT pLKO.1 2223 CDS 100% 4.050 2.835 N Fbxo38 n/a
9 TRCN0000138189 CCAAACTTAGTGGGTGTGGAA pLKO.1 1438 CDS 100% 2.640 1.848 N FBXO38 n/a
10 TRCN0000175377 CCTGTATCAAATATCTGGCAA pLKO.1 2222 CDS 100% 2.640 1.848 N Fbxo38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09069 pDONR223 100% 93.6% 93.6% None 409G>T;2428_2652del n/a
2 ccsbBroad304_09069 pLX_304 0% 93.6% 93.6% V5 409G>T;2428_2652del n/a
3 ccsbBroadEn_12717 pDONR223 100% 79.3% 79.3% None 1914_2648del n/a
4 ccsbBroad304_12717 pLX_304 0% 79.3% 79.3% V5 1914_2648del n/a
5 TRCN0000471001 CTAGATGGCACTAGGATAACCACC pLX_317 13.5% 79.3% 79.3% V5 1914_2648del n/a
6 ccsbBroadEn_16008 pDONR223 0% 35.8% 35.8% None 1_2286del n/a
7 ccsbBroad304_16008 pLX_304 0% 35.8% 35.8% V5 1_2286del n/a
8 TRCN0000478966 GTGCCATGCGGCGACGTTTAAGTC pLX_317 29.6% 35.8% 35.8% V5 1_2286del n/a
Download CSV