Transcript: Mouse XM_006525502.3

PREDICTED: Mus musculus F-box protein 38 (Fbxo38), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxo38 (107035)
Length:
4270
CDS:
270..3629

Additional Resources:

NCBI RefSeq record:
XM_006525502.3
NBCI Gene record:
Fbxo38 (107035)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525502.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249720 GTGGATGCGACTGGTTGATAT pLKO_005 1544 CDS 100% 13.200 18.480 N Fbxo38 n/a
2 TRCN0000249724 CGTAATCGTAACGGAGCATTT pLKO_005 774 CDS 100% 10.800 15.120 N Fbxo38 n/a
3 TRCN0000173406 GCAGATCAAAGCCGATATGAA pLKO.1 2312 CDS 100% 5.625 7.875 N Fbxo38 n/a
4 TRCN0000215399 CATCAATCAAGAGCTCATTAA pLKO.1 3224 CDS 100% 13.200 9.240 N Fbxo38 n/a
5 TRCN0000249721 CATCAATCAAGAGCTCATTAA pLKO_005 3224 CDS 100% 13.200 9.240 N Fbxo38 n/a
6 TRCN0000249722 GTGTTTATATTTGGCATATTC pLKO_005 4108 3UTR 100% 13.200 9.240 N Fbxo38 n/a
7 TRCN0000175255 CTGTATCAAATATCTGGCAAT pLKO.1 1469 CDS 100% 4.050 2.835 N Fbxo38 n/a
8 TRCN0000175377 CCTGTATCAAATATCTGGCAA pLKO.1 1468 CDS 100% 2.640 1.848 N Fbxo38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525502.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09069 pDONR223 100% 88.3% 93.6% None (many diffs) n/a
2 ccsbBroad304_09069 pLX_304 0% 88.3% 93.6% V5 (many diffs) n/a
3 ccsbBroadEn_12717 pDONR223 100% 74.3% 80.3% None (many diffs) n/a
4 ccsbBroad304_12717 pLX_304 0% 74.3% 80.3% V5 (many diffs) n/a
5 TRCN0000471001 CTAGATGGCACTAGGATAACCACC pLX_317 13.5% 74.3% 80.3% V5 (many diffs) n/a
6 ccsbBroadEn_16008 pDONR223 0% 26.3% 28.5% None (many diffs) n/a
7 ccsbBroad304_16008 pLX_304 0% 26.3% 28.5% V5 (many diffs) n/a
8 TRCN0000478966 GTGCCATGCGGCGACGTTTAAGTC pLX_317 29.6% 26.3% 28.5% V5 (many diffs) n/a
Download CSV