Construct: ORF TRCN0000479417
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017472.1_s317c1
- Derived from:
- ccsbBroadEn_10588
- DNA Barcode:
- GACGAAACCCTTTCATATAAAGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PIPSL (266971)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479417
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 266971 | PIPSL | PIP5K1A and PSMD4 like (pse... | NR_002319.2 | 68.4% | (many diffs) | |
| 2 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_024450131.1 | 56.3% | 54.3% | (many diffs) |
| 3 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711567.4 | 55.5% | 53.6% | (many diffs) |
| 4 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510048.3 | 55.5% | 53.6% | (many diffs) |
| 5 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510049.3 | 55.5% | 53.6% | (many diffs) |
| 6 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_017002441.2 | 55.5% | 53.6% | (many diffs) |
| 7 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510046.3 | 54.6% | 52.7% | (many diffs) |
| 8 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245532.4 | 54.6% | 52.6% | (many diffs) |
| 9 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_003557.3 | 54.1% | 52.2% | (many diffs) |
| 10 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001330689.2 | 54.1% | 52.1% | (many diffs) |
| 11 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510045.3 | 53.9% | 52% | (many diffs) |
| 12 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245530.5 | 53.8% | 51.9% | (many diffs) |
| 13 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_024450130.1 | 53.8% | 51.9% | (many diffs) |
| 14 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510043.3 | 53.8% | 51.9% | (many diffs) |
| 15 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245528.5 | 53.5% | 51.6% | (many diffs) |
| 16 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245527.4 | 53.4% | 51.5% | (many diffs) |
| 17 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001135638.2 | 53.4% | 51.5% | (many diffs) |
| 18 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711564.4 | 53.4% | 51.5% | (many diffs) |
| 19 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_024450129.1 | 53.1% | 51.2% | (many diffs) |
| 20 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711568.4 | 53.1% | 51.2% | (many diffs) |
| 21 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245525.5 | 52.8% | 50.9% | (many diffs) |
| 22 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711563.4 | 52.7% | 50.8% | (many diffs) |
| 23 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001135636.2 | 51% | 49% | (many diffs) |
| 24 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001135637.2 | 48.9% | 47.3% | (many diffs) |
| 25 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_017002440.1 | 45.7% | 44.4% | (many diffs) |
| 26 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_017002439.1 | 45.7% | 44.4% | (many diffs) |
| 27 | human | 5710 | PSMD4 | proteasome 26S subunit, non... | NM_002810.3 | 42.1% | 40.1% | (many diffs) |
| 28 | human | 5710 | PSMD4 | proteasome 26S subunit, non... | NM_001330692.2 | 41.9% | 40% | (many diffs) |
| 29 | mouse | 18720 | Pip5k1a | phosphatidylinositol-4-phos... | NM_008847.3 | 48.2% | 48.4% | (many diffs) |
| 30 | mouse | 18720 | Pip5k1a | phosphatidylinositol-4-phos... | NM_001293707.1 | 48.1% | 48.3% | (many diffs) |
| 31 | mouse | 18720 | Pip5k1a | phosphatidylinositol-4-phos... | XM_017319485.1 | 43.5% | 44.3% | (many diffs) |
| 32 | mouse | 19185 | Psmd4 | proteasome (prosome, macrop... | NM_008951.2 | 38.2% | 38.3% | (many diffs) |
| 33 | mouse | 19185 | Psmd4 | proteasome (prosome, macrop... | NM_001282017.1 | 38.1% | 38.2% | (many diffs) |
| 34 | mouse | 19185 | Psmd4 | proteasome (prosome, macrop... | XM_006501137.2 | 27.4% | 27.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2655
- ORF length:
- 2586
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcatctgag gtgccttatg cctctggcat gcccatcaag aaaataggcc 121 atagaagtgt tgattcctca ggagggacaa cctcatcagc cttgaaaggt gccatccagt 181 taggcattac ccacactgtg gggagcctga gtaccaaacc agagagtgat gtcctcatgc 241 aagatttcca catggtggag agtatcttct ttcccagtga agggagcaac ctgacccctg 301 ctcatcacta caatgccttt cgtttcaaga cctatgcacc tgttgccttc cgctacttct 361 gggagctatt tggtatccgg cccgatgatt acttgtattc cctctgcagt gagccgctga 421 ttgaactctg tagctctgga gctagtggtt ccctgttcta tgtgtccagc gacgatgagt 481 tcattgttaa gacagtccga cataaagaag cggagtttct gcagaagctg cttccaggat 541 actacataaa cctcaaccag aaccctcgga ctttgctgcc taaattctat ggactgtact 601 gtgtgcagac aggtggcaag aacattcgga ttgtggtgat gaacaatctt ttaccaagat 661 cggtaaaaat gcatatcaaa tatgacctca aaggctcaac ctacaggcgg cgggcttccc 721 agaaagagcg agagaagcct cttcccacat ttaaagacct agacttctta caagacatcc 781 ctgatggtct ttttttggat gctgacgtgc acaacgctct ctgtaagacc ctgcagcgtg 841 actgtttggt gctgcagagc ttcaagataa tggattatag cctcttgatg tcaatccata 901 atatagatca tgcacaacga gagcccttaa gcagcgaaac acaatactca gttgatactc 961 gaagaccagc cccccaaaag gctctgtatt ccacagccat ggaatccatc cagggagagg 1021 ctcgacgggg tggcaccatg gagaccgatg accatatggg tggcatccct gcccggaata 1081 gtaaagggga aaggcttctg ctttatattg gcatcattga cattctacag tcttacaggt 1141 ttgttaagaa gttggagcac tcttggaaag ccctgataca tgacggagac actgtctcag 1201 tgcatcgccc aggcttctat gctgaatggt tccagcgctt catgtgcaac acggtattta 1261 agaagattcc cttgaagcct tctccttcca aaaaacttcg gtctggctca tctttctctc 1321 agcgagcagg ctccagtggc aactcctgca ttacttacaa gccattggtc tctggggaac 1381 acaaggcaca agtgacaaca aaggcggaag tggagccagg tgttcacctt ggttgtcctg 1441 atgttttacc tcagactcca cctttggagg aaatcagtga gggctcacct actcctgacc 1501 ccagtttctc acctctagtt gaagagactt tgcaaatgct aactacaagc gtggacaaca 1561 gtgagtatat ggggaatgga gacttcttac ccacccggct gcaggcccag caggatgctg 1621 tcaacacagt ttgtcattca aagacccgca gcaaccctga gaacaacgtg ggccttatca 1681 cactggataa tgactgtgaa gtgctgacca cactcacccc agacactggc cgtatcctgt 1741 ccaagctaca tactgtccaa cccaagggca agatcacctt ctgcatgggc atccacgtgg 1801 cccatctggc tctgaagcac cgacaaggca acaatcacaa gatccgcatc attgcctttg 1861 tgggaaaccc ggtggaggac aatgagaaga atctggtgaa actggctaaa tgcctcaaga 1921 aggagaaagt aaatgttgac attatcaatt ttggggaaga ggaggtgaac acagaaaagc 1981 tgacagcctt tgtaaacacg ttgaatggca aagatggaac cggttctcat ctggtgacag 2041 tgcctcctgg gcccagtttg gctgatgctc tcatcagttt tccgattttg gctggtgaag 2101 gtggtgccat gatgggtctt ggtgccagtg actttgaatt tggagtagat cccagtgctg 2161 atcctgagct ggccttggtc cttcgtgtat ttatggaaga gcagcggcag cggcaggagg 2221 aggaggcccg gcaggcagct gcagcttctg ctgctgaggc cgggattgct acgactggga 2281 ctgaagactc agacgatgcc ctgctgaaga tgaccatcag ccagcaagag tttggccaca 2341 ctgggcttcc tgaccTAAGC AGTATGACTG AGGAAGAGAA GATTGTTTGT GCCATGCAGA 2401 TGTCCCTGCA GGGAGCAGAG TTTGGCCTGG CAGAATCAGC AGACATTGAT GCCAGCTCAG 2461 CCATGGACAC ATCTGAGCCA GCCAAGGAGG AGGATGATTA CGACGTGATG CAAGACCCTG 2521 AGTTCCTTCA GAGTGTCCTA GAGAACCTCC CAGGTGTGGA TCCCAACAAT GAAGCCATTC 2581 GAAATGCTGT GGGCTCCCTG GCCTCCCAGG CCACCAAGGA CAGCAAGAAG GACAAGAAGG 2641 AGGAAGACGA GAAGTTGCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 2701 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 2761 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GACGAAACCC TTTCATATAA 2821 AGATACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt