Transcript: Human NM_031963.3

Homo sapiens keratin associated protein 9-8 (KRTAP9-8), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
KRTAP9-8 (83901)
Length:
1006
CDS:
54..533

Additional Resources:

NCBI RefSeq record:
NM_031963.3
NBCI Gene record:
KRTAP9-8 (83901)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_031963.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254298 ACCATGCTCTCACCCAAATTT pLKO_005 627 3UTR 100% 15.000 7.500 Y KRTAP9-8 n/a
2 TRCN0000160216 CCATCCTCACACAACAAATTT pLKO.1 553 3UTR 100% 15.000 7.500 Y KRTAP9-2 n/a
3 TRCN0000159052 GCTTCATCTGTTCTCAAGTTT pLKO.1 752 3UTR 100% 5.625 2.813 Y KRTAP9-2 n/a
4 TRCN0000160501 CTCTAAAGTCAAGAGCTTCAT pLKO.1 794 3UTR 100% 4.950 2.475 Y KRTAP9-2 n/a
5 TRCN0000162948 GAGCTTCATTCCCTGCTTCTA pLKO.1 806 3UTR 100% 4.950 2.475 Y KRTAP9-2 n/a
6 TRCN0000151172 GCAGAATACTTCATCCTGATT pLKO.1 697 3UTR 100% 4.950 2.475 Y KRTAP9-4 n/a
7 TRCN0000159752 GCAGAATACTTCATCCTGATT pLKO.1 697 3UTR 100% 4.950 2.475 Y KRTAP9-2 n/a
8 TRCN0000159137 GCTTCTAAGGAATTTAGGTTT pLKO.1 820 3UTR 100% 4.950 2.475 Y KRTAP9-2 n/a
9 TRCN0000254297 GTGCACCTGTGTACTGCAGAA pLKO_005 340 CDS 100% 4.050 2.025 Y KRTAP9-8 n/a
10 TRCN0000265533 TACTGCAGAAGAACCTGCTAC pLKO_005 351 CDS 100% 4.050 2.025 Y KRTAP9-8 n/a
11 TRCN0000254295 TTCTTGCTGCTGATCACGTTC pLKO_005 521 CDS 100% 4.050 2.025 Y KRTAP9-8 n/a
12 TRCN0000254296 CTGCCTGCCTGGTTGCCTAAA pLKO_005 386 CDS 100% 3.600 1.800 Y KRTAP9-8 n/a
13 TRCN0000162114 CCTCATCGTTCTTGTATCCTT pLKO.1 891 3UTR 100% 3.000 1.500 Y KRTAP9-2 n/a
14 TRCN0000164474 CAAGAGCTTCATTCCCTGCTT pLKO.1 803 3UTR 100% 2.640 1.320 Y KRTAP9-2 n/a
15 TRCN0000160138 CAGCTTTGACTCTAAAGTCAA pLKO.1 785 3UTR 100% 0.495 0.248 Y KRTAP9-2 n/a
16 TRCN0000116660 CTGCTGTGTGTCCAGCTGCTT pLKO.1 161 CDS 100% 0.880 0.440 Y KRTAP4-2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_031963.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04306 pDONR223 100% 99.3% 98.7% None 371A>G;426C>A;452C>A n/a
2 ccsbBroad304_04306 pLX_304 0% 99.3% 98.7% V5 371A>G;426C>A;452C>A n/a
3 TRCN0000476026 ATCAGCAATATCTCCCACCGGAGC pLX_317 56.2% 99.3% 98.7% V5 371A>G;426C>A;452C>A n/a
4 ccsbBroadEn_09132 pDONR223 100% 91% 91.4% None (many diffs) n/a
5 ccsbBroad304_09132 pLX_304 0% 91% 91.4% V5 (many diffs) n/a
6 TRCN0000476098 GATAGGTGAAAGTCGACACAGCAC pLX_317 64.6% 91% 91.4% V5 (many diffs) n/a
7 ccsbBroadEn_09131 pDONR223 100% 89.4% 87.9% None (many diffs) n/a
8 ccsbBroad304_09131 pLX_304 0% 89.4% 87.9% V5 (many diffs) n/a
9 TRCN0000465512 TACGGGCCCGTGCACATTAAAAAG pLX_317 75.2% 89.4% 87.9% V5 (many diffs) n/a
10 ccsbBroadEn_15184 pDONR223 61.6% 88.5% 87.9% None (many diffs) n/a
11 ccsbBroad304_15184 pLX_304 0% 88.5% 87.9% V5 (many diffs) n/a
12 TRCN0000476293 GATTTATAGACGAGAGCGAATCTG pLX_317 100% 41% 42% V5 (many diffs) n/a
13 TRCN0000479599 AGTGGAAAGGCTAATTTGGGTACC pLX_317 100% 41% 42% V5 (many diffs) n/a
Download CSV