Transcript: Human XM_003846481.1

PREDICTED: Homo sapiens keratin associated protein 9-6 (KRTAP9-6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KRTAP9-6 (100507608)
Length:
525
CDS:
1..525

Additional Resources:

NCBI RefSeq record:
XM_003846481.1
NBCI Gene record:
KRTAP9-6 (100507608)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_003846481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116660 CTGCTGTGTGTCCAGCTGCTT pLKO.1 123 CDS 100% 0.880 0.440 Y KRTAP4-2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_003846481.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09131 pDONR223 100% 94.4% 89.6% None (many diffs) n/a
2 ccsbBroad304_09131 pLX_304 0% 94.4% 89.6% V5 (many diffs) n/a
3 TRCN0000465512 TACGGGCCCGTGCACATTAAAAAG pLX_317 75.2% 94.4% 89.6% V5 (many diffs) n/a
4 ccsbBroadEn_15184 pDONR223 61.6% 93.6% 90.2% None (many diffs) n/a
5 ccsbBroad304_15184 pLX_304 0% 93.6% 90.2% V5 (many diffs) n/a
6 TRCN0000476293 GATTTATAGACGAGAGCGAATCTG pLX_317 100% 44.6% 43.1% V5 (many diffs) n/a
7 TRCN0000479599 AGTGGAAAGGCTAATTTGGGTACC pLX_317 100% 44.6% 43.1% V5 (many diffs) n/a
8 ccsbBroadEn_04306 pDONR223 100% 86% 82.7% None (many diffs) n/a
9 ccsbBroad304_04306 pLX_304 0% 86% 82.7% V5 (many diffs) n/a
10 TRCN0000476026 ATCAGCAATATCTCCCACCGGAGC pLX_317 56.2% 86% 82.7% V5 (many diffs) n/a
11 ccsbBroadEn_09132 pDONR223 100% 85.8% 84.4% None (many diffs) n/a
12 ccsbBroad304_09132 pLX_304 0% 85.8% 84.4% V5 (many diffs) n/a
13 TRCN0000476098 GATAGGTGAAAGTCGACACAGCAC pLX_317 64.6% 85.8% 84.4% V5 (many diffs) n/a
Download CSV