Construct: ORF TRCN0000479724
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002955.1_s317c1
- Derived from:
- ccsbBroadEn_14983
- DNA Barcode:
- AATACAGTCTCGATGTATTCGCGG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LILRB5 (10990)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479724
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79168 | LILRA6 | leukocyte immunoglobulin li... | XM_011547130.2 | 56.8% | 48.9% | (many diffs) |
| 2 | human | 79168 | LILRA6 | leukocyte immunoglobulin li... | NM_024318.4 | 54.9% | 47.4% | (many diffs) |
| 3 | human | 79168 | LILRA6 | leukocyte immunoglobulin li... | NM_001360167.1 | 54.7% | 47.1% | (many diffs) |
| 4 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | NM_006840.5 | 53.3% | 53% | 938A>C;944_953delTGATCGCAGG;956_1770del |
| 5 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | NM_001081442.3 | 53.2% | 52.9% | 938A>C;944_953delTGATCGCAGG;956_1773del |
| 6 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | XM_011526361.2 | 48.1% | 47.9% | 938A>C;944_953delTGATCGCAGG;956_1959del |
| 7 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | XM_011526360.2 | 47% | 46.7% | 938A>C;944_953delTGATCGCAGG;956_2007del |
| 8 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | XM_011526359.2 | 46.9% | 46.7% | 938A>C;944_953delTGATCGCAGG;956_2010del |
| 9 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XR_001756784.2 | 46.7% | (many diffs) | |
| 10 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | NM_001304457.2 | 45.6% | 45.3% | (many diffs) |
| 11 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XM_006726314.4 | 42% | 36.1% | (many diffs) |
| 12 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XM_006726313.4 | 41.9% | 36% | (many diffs) |
| 13 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | XR_935723.1 | 41.9% | (many diffs) | |
| 14 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | XR_935722.1 | 41.8% | (many diffs) | |
| 15 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XM_011548575.3 | 40.9% | 35.1% | (many diffs) |
| 16 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XM_011548574.3 | 40.8% | 35.1% | (many diffs) |
| 17 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | NM_001081443.3 | 36.3% | 36% | (many diffs) |
| 18 | human | 102725035 | LOC102725035 | leukocyte immunoglobulin-li... | XR_001756785.2 | 35.6% | (many diffs) | |
| 19 | human | 10990 | LILRB5 | leukocyte immunoglobulin li... | XM_011526362.2 | 32% | 31.7% | (many diffs) |
| 20 | human | 79168 | LILRA6 | leukocyte immunoglobulin li... | NR_104098.2 | 30.9% | (many diffs) | |
| 21 | human | 11025 | LILRB3 | leukocyte immunoglobulin li... | NR_135494.2 | 26.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1011
- ORF length:
- 945
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac cctcaccctc tcagtcctga tttgcctcgg gctgagtgtg ggccccagga 121 cctgcgtgca ggcaggcacc ctccccaaac ccaccctctg ggctgagcca gcctctgtga 181 tagctcgggg gaagcccgtg accctctggt gtcaggggcc cctggagact gaggagtacc 241 gtctggataa ggagggactc ccatgggccc ggaagagaca gaacccactg gagcctggag 301 ccaaggccaa gttccacatt ccatccacgg tgtatgacag tgcagggcga taccgctgct 361 actatgagac ccctgcaggc tggtcagagc ccagtgaccc cctggagctg gtggcgacag 421 gattctatgc agaacccact cttttagccc tgccgagtcc tgtggtggcc tcaggaggaa 481 atgtgaccct ccagtgtgat acactggacg gacttctcac gtttgttctt gttgaggaag 541 aacagaagct ccccaggacc ctgtactcac agaagctccc caaagggcca tcccaggccc 601 tgttccctgt gggtcccgtg acccccagct gcaggtggag gttcagatgc tattactatt 661 acaggaaaaa cccTCAGGTG TGGTCGAACC CCAGTGACCT CCTGGAGATT CTGGTCCCAG 721 GCGTGTCTAG GAAGCCCTCC CTCCTGATCC CGCAGGGCTC TGTCGTGGCC CGCGGAGGCA 781 GCCTGACCCT GCAGTGTCGC TCTGATGTCG GCTATGACAT ATTCGTTCTG TACAAGGAGG 841 GGGAACATGA CCTCGTCCAG GGCTCTGGCC AGCAGCCCCA GGCTGGGCTC TCCCAGGCCA 901 ACTTCACCCT GGGCCCTGTG AGCCGCTCCC ACGGGGGCCA GTACAGATGC TACGGTGCAC 961 ACAACCTCTC CCCTAGGTGG TCGGCCCCCA GCGACCCCCT GGCCATCCAC TACCCAACTT 1021 ACTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1081 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1141 CTTGTGGAAA GGACGAAATA CAGTCTCGAT GTATTCGCGG ACGCGTTAAG TCgacaatca 1201 acctctggat tacaaaattt gtgaaagatt