Transcript: Human NM_024318.4

Homo sapiens leukocyte immunoglobulin like receptor A6 (LILRA6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
LILRA6 (79168)
Length:
1889
CDS:
40..1485

Additional Resources:

NCBI RefSeq record:
NM_024318.4
NBCI Gene record:
LILRA6 (79168)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024318.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422807 ACCTTACTTCCAATCTATGTT pLKO_005 1650 3UTR 100% 5.625 7.875 N LILRA6 n/a
2 TRCN0000434353 ATCATGTCTGATCACAAATTT pLKO_005 1620 3UTR 100% 15.000 10.500 N LILRA6 n/a
3 TRCN0000060498 CCATCCATAACAGAGCACCAT pLKO.1 295 CDS 100% 2.640 1.584 N LILRA6 n/a
4 TRCN0000056784 GTGGAGGTTCACATGCTATTA pLKO.1 612 CDS 100% 13.200 6.600 Y LILRB3 n/a
5 TRCN0000419260 TGGTGGCAGTTTGACACTTTC pLKO_005 1081 CDS 100% 10.800 5.400 Y LILRB3 n/a
6 TRCN0000060502 GACACTTTCCTTCTGACCAAA pLKO.1 1093 CDS 100% 4.950 2.475 Y LILRA6 n/a
7 TRCN0000056787 GCTCATAAGTACCAGGCTGAA pLKO.1 1159 CDS 100% 4.050 2.025 Y LILRB3 n/a
8 TRCN0000060501 GACAGAAATAACCCACTGGAA pLKO.1 247 CDS 100% 2.640 1.320 Y LILRA6 n/a
9 TRCN0000056847 CGACAGATTTGTTCTGTATAA pLKO.1 792 CDS 100% 1.320 0.660 Y LILRA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024318.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11582 pDONR223 100% 72.3% 69% None (many diffs) n/a
2 ccsbBroad304_11582 pLX_304 0% 72.3% 69% V5 (many diffs) n/a
3 TRCN0000476797 GACTTACTCCCCGGATCTCGTAGG pLX_317 13.1% 72.3% 69% V5 (many diffs) n/a
4 ccsbBroadEn_14983 pDONR223 54.7% 65.7% 54.6% None (many diffs) n/a
5 ccsbBroad304_14983 pLX_304 0% 65.7% 54.6% V5 (many diffs) n/a
6 TRCN0000479724 AATACAGTCTCGATGTATTCGCGG pLX_317 36% 54.9% 47.4% V5 (many diffs) n/a
Download CSV