Transcript: Human NM_001304457.2

Homo sapiens leukocyte immunoglobulin like receptor B5 (LILRB5), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
LILRB5 (10990)
Length:
2432
CDS:
81..2066

Additional Resources:

NCBI RefSeq record:
NM_001304457.2
NBCI Gene record:
LILRB5 (10990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001304457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056871 GACGGACTTCTCACGTTTGTT pLKO.1 495 CDS 100% 5.625 7.875 N LILRB5 n/a
2 TRCN0000056870 GCATCAGATAGACACTTTCTT pLKO.1 1094 CDS 100% 5.625 4.500 N LILRB5 n/a
3 TRCN0000432030 ACCGATGCTACAGCGCAATCA pLKO_005 1231 CDS 100% 4.950 3.960 N LILRB5 n/a
4 TRCN0000056869 GCTGACATCCAGGAGGAAATT pLKO.1 1605 CDS 100% 13.200 9.240 N LILRB5 n/a
5 TRCN0000056868 GCTGTGTCTAAAGTCAAAGTA pLKO.1 1145 CDS 100% 5.625 3.938 N LILRB5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001304457.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14983 pDONR223 54.7% 86.5% 86.4% None (many diffs) n/a
2 ccsbBroad304_14983 pLX_304 0% 86.5% 86.4% V5 (many diffs) n/a
3 TRCN0000479724 AATACAGTCTCGATGTATTCGCGG pLX_317 36% 45.6% 45.3% V5 (many diffs) n/a
4 ccsbBroadEn_11582 pDONR223 100% 78.3% 68.5% None (many diffs) n/a
5 ccsbBroad304_11582 pLX_304 0% 78.3% 68.5% V5 (many diffs) n/a
6 TRCN0000476797 GACTTACTCCCCGGATCTCGTAGG pLX_317 13.1% 78.3% 68.5% V5 (many diffs) n/a
Download CSV