Transcript: Mouse NM_170599.2

Mus musculus immunoglobulin superfamily, member 11 (Igsf11), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Igsf11 (207683)
Length:
3430
CDS:
164..1450

Additional Resources:

NCBI RefSeq record:
NM_170599.2
NBCI Gene record:
Igsf11 (207683)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_170599.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000250088 GCCCGAACAGGTCATTCTTTA pLKO_005 370 CDS 100% 13.200 18.480 N Igsf11 n/a
2 TRCN0000250090 TCCACGGGAGGGTAGGATTTA pLKO_005 426 CDS 100% 13.200 18.480 N Igsf11 n/a
3 TRCN0000250087 ACAGTCACCATCCGGAATATC pLKO_005 758 CDS 100% 13.200 10.560 N Igsf11 n/a
4 TRCN0000250086 GTAGAGTTTAGTAGGTTATTA pLKO_005 2558 3UTR 100% 15.000 10.500 N Igsf11 n/a
5 TRCN0000250089 TCATCTGCCTTGCACTAATTT pLKO_005 927 CDS 100% 15.000 10.500 N Igsf11 n/a
6 TRCN0000201466 CCCGAACAGGTCATTCTTTAT pLKO.1 371 CDS 100% 13.200 9.240 N Igsf11 n/a
7 TRCN0000190728 GCAATGCAGTTATCCCATCAA pLKO.1 1203 CDS 100% 4.950 3.465 N Igsf11 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2078 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_170599.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09684 pDONR223 100% 84.9% 85.4% None (many diffs) n/a
2 ccsbBroad304_09684 pLX_304 0% 84.9% 85.4% V5 (many diffs) n/a
3 TRCN0000480176 TTCCTACGGGACCTCAATCGAACG pLX_317 25.9% 84.9% 85.4% V5 (many diffs) n/a
Download CSV