Construct: ORF TRCN0000480671
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006981.1_s317c1
- Derived from:
- ccsbBroadEn_03562
- DNA Barcode:
- CTGAAGATAAAAGGAGGGATAAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- YY1AP1 (55249)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480671
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198901.1 | 100% | 100% | |
| 2 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198902.1 | 100% | 100% | |
| 3 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_139119.2 | 100% | 100% | |
| 4 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198899.1 | 98.5% | 98.5% | 0_1ins33 |
| 5 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198900.1 | 98.5% | 98.5% | 0_1ins33 |
| 6 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_018253.3 | 98.5% | 98.5% | 0_1ins33 |
| 7 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198905.1 | 97.3% | 97.3% | 728_729ins60 |
| 8 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_139121.2 | 91.2% | 91.2% | 0_1ins198 |
| 9 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_139118.2 | 89.4% | 89.4% | 1_198del;926_927ins60 |
| 10 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198903.1 | 84.4% | 84.4% | 1_414del |
| 11 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198904.1 | 82.2% | 82.2% | 1_414del;1142_1143ins60 |
| 12 | human | 54856 | GON4L | gon-4 like | NM_001282861.2 | 47.2% | 45.6% | (many diffs) |
| 13 | human | 54856 | GON4L | gon-4 like | NM_032292.6 | 47.2% | 45.6% | (many diffs) |
| 14 | human | 55249 | YY1AP1 | YY1 associated protein 1 | NM_001198906.2 | 42.7% | 40.3% | 1_198del;1193_1212del;1272_1273ins1196 |
| 15 | human | 54856 | GON4L | gon-4 like | XM_005245284.3 | 34.9% | 33.7% | (many diffs) |
| 16 | human | 54856 | GON4L | gon-4 like | XM_011509659.2 | 34.9% | 33.7% | (many diffs) |
| 17 | human | 54856 | GON4L | gon-4 like | NM_001282858.2 | 32.2% | 31.1% | (many diffs) |
| 18 | human | 54856 | GON4L | gon-4 like | XM_006711393.3 | 32.2% | 31.1% | (many diffs) |
| 19 | human | 54856 | GON4L | gon-4 like | XM_006711394.4 | 32.2% | 31.1% | (many diffs) |
| 20 | human | 54856 | GON4L | gon-4 like | NM_001282856.1 | 32.2% | 31.1% | (many diffs) |
| 21 | human | 54856 | GON4L | gon-4 like | NM_001282860.1 | 32.2% | 31.1% | (many diffs) |
| 22 | human | 54856 | GON4L | gon-4 like | XM_005245286.3 | 31.3% | 30.2% | (many diffs) |
| 23 | human | 54856 | GON4L | gon-4 like | XM_011509658.2 | 31% | 30% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2316
- ORF length:
- 2250
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga agatctgttt gaaactttcc aagatgagat gggattctcc aacatggaag 121 atgatggccc agaagaggag gagcgtgtgg ctgagcctca agctaacttt aacacccctc 181 aagctctacg gtttgaggaa ctactggcca acctactaaa tgaacaacat cagatagcga 241 aggaactatt tgaacagctg aagatgaaga aaccttcagc caaacagcag aaggaggtag 301 agaaggttaa accccagtgt aaggaagttc atcagaccct gattctggac ccagcacaaa 361 ggaagagact ccagcagcag atgcagcagc atgttcagct cttgacacaa atccaccttc 421 ttgccacctg caaccccaat ctcaatccgg aggccagtag caccaggata tgtcttaaag 481 agctgggaac ctttgctcaa agctccatcg cccttcacca tcagtacaac cccaagtttc 541 agaccctgtt ccaaccctgt aacttgatgg gagctatgca gctgattgaa gacttcagca 601 cacatgtcag cattgactgc agccctcata aaactgtcaa gaagactgcc aatgaatttc 661 cctgtttgcc aaagcaagtg gcttggatcc tggccacaag caaggttttc atgtatccag 721 agttacttcc agtgtgttcc ctgaaggcaa agaatcccca ggataagatc ctcttcacca 781 aggctgagga caatttgtta gctttaggac tgaagcattt tgaagggact gagtttctta 841 accctctaat cagcaagtac cttctaacct gcaagactgc ccgccaactg acagtgagaa 901 tcaagaacct caacatgaac agagctcctg acaacatcat taaattttat aagaagacca 961 aacagctgcc agtcctagga aaatgctgtg aagagatcca gccacatcag tggaagccac 1021 ctatagagag agaagaacac cggctcccat tctggttaaa ggccagtctg ccatccatcc 1081 aggaagaact gcggcacatg gctgatggtg ctagagaggt aggaaatatg actggaacca 1141 ctgagatcaa ctcagatcaa ggcctagaaa aagacaactc agagttgggg agtgaaactc 1201 ggtacccact gctattgcct aagggtgtag tcctgaaact gaagccagtt gccgaccgtt 1261 tccccaagaa ggcttggaga cagaagcgtt catcagtcct gaaacccctc cttatccaac 1321 ccagcccctc tctccagccc agcttcaacc ctgggaaaac accagcccaa tcaactcatt 1381 cagaagcccc tccgagcaaa atggtgctcc ggattcctca cccaatacag ccagccactg 1441 ttttacagac agttccaggt gtccctccac tgggggtcag tggaggtgag agttttgagt 1501 ctcctgcagc actgcctgct atgccccctg aggccaggac aagcttccct ctgtctgagt 1561 cccagacttt gctctcttct gcccctgtgc ccaaggtaat gatgccctcc cctgcctctt 1621 ccatgtttcg aaagccatat gtgagacgga gaccctcaaa aagaagggga gccagggcct 1681 ttcgctgtat caaacctgcc cctgttatcc accctgcatc tgttatcttc actgttcctg 1741 ctaccactgt gaagattgtg agccttggcg gtggctgtaa catgatccag cctgtcaatg 1801 cggctgtggc ccagagtccc cagactattc ccatcgccac cctcttggtt aaccctactt 1861 ccttcccctg tccattgaac cagccccttg tggcctcctc tgtctcaccc ttaattgttT 1921 CTGGCAATTC TGTGAATCTT CCTATACCAT CCACCCCTGA AGATAAGGCC CACATGAATG 1981 TGGACATTGC TTGTGCTGTG GCTGATGGGG AAAATGCCTT TCAGGGCCTA GAACCCAAAT 2041 TAGAGCCCCA GGAACTATCT CCTCTCTCTG CTACTGTTTT CCCCAAAGTG GAACATAGCC 2101 CAGGGCCTCC ACCAGTCGAT AAACAGTGCC AAGAAGGATT GTCAGAGAAC AGTGCCTATC 2161 GCTGGACCGT TGTGAAAACA GAGGAGGGAA GGCAAGCTCT GGAGCCGCTC CCTCAGGGCA 2221 TCCAGGAGTC TCTAAACAAC TCTTCCCCTG GGGATTTAGA GGAAGTTGTC AAGATGGAAC 2281 CTGAAGATGC TACAGAGGAA ATCAGTGGAT TTCTTTGCCC AACTTTCTTG TACAAAGTGG 2341 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 2401 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 2461 ACTGAAGATA AAAGGAGGGA TAAATACGCG TTAAGTCgac aatcaacctc tggattacaa 2521 aatttgtgaa agatt