Transcript: Human NR_146339.1

Homo sapiens PPIP5K1P1-CATSPER2 readthrough (PPIP5K1P1-CATSPER2), non-coding RNA.

Source:
NCBI, updated 2018-05-09
Taxon:
Homo sapiens (human)
Gene:
PPIP5K1P1-CATSPER2 (110006325)
Length:
5282
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_146339.1
NBCI Gene record:
PPIP5K1P1-CATSPER2 (110006325)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_146339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424850 AGACTCACTCTTCCGATATTT pLKO_005 5029 3UTR 100% 15.000 7.500 Y CATSPER2 n/a
2 TRCN0000043713 GCCACTGAAGAGGATTTAATA pLKO.1 4802 3UTR 100% 15.000 7.500 Y CATSPER2 n/a
3 TRCN0000128377 GCTACAAGACAGGGAAATTAA pLKO.1 1519 3UTR 100% 15.000 7.500 Y PPIP5K1 n/a
4 TRCN0000043715 GCTAGTGCGTTTCTCTATAAA pLKO.1 3839 3UTR 100% 15.000 7.500 Y CATSPER2 n/a
5 TRCN0000431015 ACGTTCGAACGCGTCTCTATT pLKO_005 2722 3UTR 100% 13.200 6.600 Y PPIP5K1 n/a
6 TRCN0000432167 GTGTCTGAAGTAGAGTCTAAT pLKO_005 4775 3UTR 100% 13.200 6.600 Y CATSPER2 n/a
7 TRCN0000426823 AGCGTCTCTTTCGTAAGATTG pLKO_005 898 3UTR 100% 10.800 5.400 Y PPIP5K1 n/a
8 TRCN0000428411 GGGCGCTATGATATCAGTAAG pLKO_005 2421 3UTR 100% 10.800 5.400 Y PPIP5K1 n/a
9 TRCN0000043716 CCACATCCTCTTCCTATTCTT pLKO.1 4893 3UTR 100% 5.625 2.813 Y CATSPER2 n/a
10 TRCN0000043714 CGATCATATTGATGGTTGAAA pLKO.1 4015 3UTR 100% 5.625 2.813 Y CATSPER2 n/a
11 TRCN0000178466 GCGCTATGATATCAGTAAGAT pLKO.1 2423 3UTR 100% 5.625 2.813 Y Ppip5k1 n/a
12 TRCN0000043717 CGGCACACTATCAGGGAGTTA pLKO.1 3771 3UTR 100% 4.950 2.475 Y CATSPER2 n/a
13 TRCN0000198957 GATCAGGTATTTGCCCTGATT pLKO.1 2265 3UTR 100% 0.495 0.248 Y Ppip5k1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_146339.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11402 pDONR223 100% 46.3% None (many diffs) n/a
2 ccsbBroad304_11402 pLX_304 0% 46.3% V5 (many diffs) n/a
3 TRCN0000480975 CACTCCTTTAGCACTTATAGATCG pLX_317 16.6% 46.3% V5 (many diffs) n/a
4 ccsbBroadEn_09442 pDONR223 100% 11% None (many diffs) n/a
5 ccsbBroad304_09442 pLX_304 0% 11% V5 (many diffs) n/a
6 TRCN0000479512 TATATGTGCACAGTCTACTCGTGT pLX_317 64.1% 11% V5 (many diffs) n/a
7 ccsbBroadEn_10638 pDONR223 100% 3.4% None (many diffs) n/a
8 ccsbBroad304_10638 pLX_304 0% 3.4% V5 (many diffs) n/a
9 TRCN0000481464 TTTCAGTACTAATAACAGGGATCT pLX_317 100% 3.4% V5 (many diffs) n/a
Download CSV