Construct: ORF TRCN0000481616
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012648.1_s317c1
- Derived from:
- ccsbBroadEn_05291
- DNA Barcode:
- TGGACCGGGGCACACATATATTGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- EBF3 (253738)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481616
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 253738 | EBF3 | EBF transcription factor 3 | NM_001005463.3 | 100% | 100% | |
2 | human | 253738 | EBF3 | EBF transcription factor 3 | XM_006717743.3 | 98.3% | 98.3% | 754_780del |
3 | human | 253738 | EBF3 | EBF transcription factor 3 | XM_005252669.3 | 93.8% | 93.6% | 1535_1642del |
4 | human | 253738 | EBF3 | EBF transcription factor 3 | XM_006717742.3 | 92.5% | 90.9% | (many diffs) |
5 | human | 253738 | EBF3 | EBF transcription factor 3 | XM_005252668.3 | 92.4% | 92.2% | 754_780del;1562_1669del |
6 | human | 253738 | EBF3 | EBF transcription factor 3 | XM_006717741.3 | 90.9% | 90.6% | (many diffs) |
7 | human | 253738 | EBF3 | EBF transcription factor 3 | XM_005252667.3 | 88.5% | 86.8% | (many diffs) |
8 | human | 253738 | EBF3 | EBF transcription factor 3 | XM_006717740.3 | 87.3% | 85.8% | (many diffs) |
9 | human | 253738 | EBF3 | EBF transcription factor 3 | XM_006717739.3 | 87.2% | 85.6% | (many diffs) |
10 | human | 253738 | EBF3 | EBF transcription factor 3 | XM_017016027.1 | 87.1% | 87.1% | 754_780del;1372_1373ins189 |
11 | human | 253738 | EBF3 | EBF transcription factor 3 | XM_006717744.3 | 81.9% | 80.3% | (many diffs) |
12 | human | 253738 | EBF3 | EBF transcription factor 3 | XM_011539574.2 | 74.6% | 73% | (many diffs) |
13 | human | 253738 | EBF3 | EBF transcription factor 3 | XM_011539575.2 | 59.1% | 56.2% | (many diffs) |
14 | human | 1879 | EBF1 | EBF transcription factor 1 | NM_001364158.1 | 55.4% | 64.5% | (many diffs) |
15 | human | 1879 | EBF1 | EBF transcription factor 1 | NM_001364159.1 | 54.6% | 63.6% | (many diffs) |
16 | human | 1879 | EBF1 | EBF transcription factor 1 | NM_001324111.2 | 54.5% | 63.5% | (many diffs) |
17 | human | 1879 | EBF1 | EBF transcription factor 1 | XM_024454393.1 | 54.5% | 63.5% | (many diffs) |
18 | human | 253738 | EBF3 | EBF transcription factor 3 | XR_001747076.1 | 32.5% | 1_506del;2128_2345del;2378_5076del | |
19 | mouse | 13593 | Ebf3 | early B cell factor 3 | NM_010096.3 | 94.3% | 99.6% | (many diffs) |
20 | mouse | 13593 | Ebf3 | early B cell factor 3 | XM_006507335.1 | 92.7% | 98% | (many diffs) |
21 | mouse | 13593 | Ebf3 | early B cell factor 3 | NM_001113414.1 | 88.5% | 93.3% | (many diffs) |
22 | mouse | 13593 | Ebf3 | early B cell factor 3 | NM_001113415.1 | 87.1% | 91.9% | (many diffs) |
23 | mouse | 13593 | Ebf3 | early B cell factor 3 | XM_011241672.1 | 86.8% | 90% | (many diffs) |
24 | mouse | 13593 | Ebf3 | early B cell factor 3 | XM_006507333.1 | 86.8% | 90.6% | (many diffs) |
25 | mouse | 13593 | Ebf3 | early B cell factor 3 | XM_006507332.1 | 83% | 86.5% | (many diffs) |
26 | mouse | 13593 | Ebf3 | early B cell factor 3 | XM_006507331.1 | 82% | 85.5% | (many diffs) |
27 | mouse | 13593 | Ebf3 | early B cell factor 3 | XM_006507329.3 | 81.8% | 85.2% | (many diffs) |
28 | mouse | 13593 | Ebf3 | early B cell factor 3 | XM_006507330.3 | 81.8% | 85.2% | (many diffs) |
29 | mouse | 13593 | Ebf3 | early B cell factor 3 | XM_006507334.1 | 79.9% | 81.7% | (many diffs) |
30 | mouse | 13593 | Ebf3 | early B cell factor 3 | XM_006507337.3 | 77% | 78.9% | (many diffs) |
31 | mouse | 13593 | Ebf3 | early B cell factor 3 | XM_006507336.1 | 76.3% | 80.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1722
- ORF length:
- 1653
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtttgggatt caggagaata ttccgcgcgg ggggacgacc atgaaggagg 121 agccgctggg cagcggcatg aacccggtgc gctcgtggat gcacacggcg ggcgtggtgg 181 acgccaacac ggccgcccag agcggcgtgg ggctggcgcg ggcgcacttc gagaagcagc 241 cgccttccaa cctccggaaa tccaatttct tccacttcgt gctggcgctc tacgataggc 301 aggggcagcc ggtggagatt gaaaggaccg cttttgtgga ctttgtggag aaagagaaag 361 agccaaacaa cgagaaaacc aacaacggca tccactataa actccagtta ttgtacagca 421 acggagtcag aacagagcaa gatctgtatg ttcgcctcat agattcaatg accaaacagg 481 ccatcgtcta cgagggccag gacaagaacc cggagatgtg ccgtgtgctg ctgacccacg 541 agatcatgtg cagccggtgc tgtgacaaga aaagttgtgg caatagaaac gaaacgccct 601 cagaccctgt aatcattgac agattctttc taaagttttt cctcaagtgc aatcagaact 661 gtttgaagaa tgcaggcaac cctcgagata tgcggagatt ccaggttgtt gtatcgacaa 721 cagtcaacgt ggacggccac gtgctggccg tgtcagacaa catgtttgtg cacaacaatt 781 ccaaacacgg gaggcgggcc cgccgcctag acccgtcaga agccactccg tgcatcaagg 841 ccatcagtcc cagtgaaggc tggaccacgg ggggtgccac cgtcatcata attggcgaca 901 acttctttga cgggctgcaa gttgtattcg gaactatgtt ggtgtggagc gagctgataa 961 ctccccatgc catccgagtc cagaccccgc cgaggcacat tcctggcgtc gtcgaagtga 1021 ccctctccta caaatccaag cagttctgca aaggtgctcc tgggcgcttt gtctacaccg 1081 cccttaatga accaaccata gattacggct ttcagaggtt gcagaaagtg atcccaagac 1141 atccgggtga tcccgaaagg ttacccaagg aggtgttact gaagcgggcg gcggacctgg 1201 tggaagcctt atacggaatg cctcacaaca accaggagaT CATCTTGAAG CGAGCGGCGG 1261 ACATCGCCGA GGCGCTGTAC AGCGTTCCCC GCAATCACAA CCAGATCCCC ACCCTGGGCA 1321 ACAACCCTGC ACACACGGGC ATGATGGGCG TCAACTCCTT CAGCAGCCAG CTAGCCGTCA 1381 ACGTGTCAGA GACGTCACAA GCCAACGACC AAGTCGGCTA CAGTCGCAAT ACAAGCAGCG 1441 TGTCCCCGCG AGGCTACGTC CCCAGCAGTA CTCCCCAGCA GTCCAATTAC AACACAGTCA 1501 GCACTAGCAT GAATGGATAT GGAAGTGGCG CCATGGCCAG TCTAGGGGTC CCTGGCTCGC 1561 CTGGATTTCT TAATGGCTCC TCCGCTAACT CTCCCTACGG CATGAAACAG AAGAGCGCCT 1621 TCGCGCCCGT GGTCCGGCCC CAAGCCTCTC CTCCTCCTTC CTGCACCAGC GCCAACGGGA 1681 ATGGACTGCA AGCTATGTCT GGGCTGGTAG TCCCGCCAAT GTTGCCAACT CTCTTGTACA 1741 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1801 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1861 AGGACGATGG ACCGGGGCAC ACATATATTG CACGCGTTAA GTCgacaatc aacctctgga 1921 ttacaaaatt tgtgaaagat t