Transcript: Mouse XM_006507337.3

PREDICTED: Mus musculus early B cell factor 3 (Ebf3), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ebf3 (13593)
Length:
2840
CDS:
537..1973

Additional Resources:

NCBI RefSeq record:
XM_006507337.3
NBCI Gene record:
Ebf3 (13593)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507337.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431436 AGCAGCCAGCTAGCCGTTAAT pLKO_005 1857 CDS 100% 13.200 18.480 N Ebf3 n/a
2 TRCN0000081570 CCTCATAGATTCAATGACCAA pLKO.1 923 CDS 100% 2.640 3.696 N Ebf3 n/a
3 TRCN0000081572 CGTTGTATCGACAACAGTCAA pLKO.1 1175 CDS 100% 0.495 0.693 N Ebf3 n/a
4 TRCN0000436557 CAACCTCCGGAAATCCAATTT pLKO_005 716 CDS 100% 13.200 10.560 N Ebf3 n/a
5 TRCN0000081569 GCCCTTAATGAGCCAACCATA pLKO.1 1575 CDS 100% 4.950 3.960 N Ebf3 n/a
6 TRCN0000081571 CTCATAGATTCAATGACCAAA pLKO.1 924 CDS 100% 4.950 3.465 N Ebf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507337.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05291 pDONR223 100% 77% 78.9% None (many diffs) n/a
2 ccsbBroad304_05291 pLX_304 0% 77% 78.9% V5 (many diffs) n/a
3 TRCN0000481616 TGGACCGGGGCACACATATATTGC pLX_317 29.4% 77% 78.9% V5 (many diffs) n/a
4 ccsbBroad304_00472 pLX_304 37.5% 63.8% 73.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_00472 pDONR223 100% 63.7% 72.3% None (many diffs) n/a
6 TRCN0000470042 CCGTCATAAGGGACACTGTAAAAG pLX_317 26.1% 63.7% 72.3% V5 (many diffs) n/a
Download CSV