Construct: ORF TRCN0000488460
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020336.1_s317c1
- DNA Barcode:
- TATGGCCTAATCTGGAGGTTGCCT
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- PKMYT1 (9088)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488460
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9088 | PKMYT1 | protein kinase, membrane as... | NM_004203.5 | 99.5% | 99.3% | 4_9delCTAGAA |
| 2 | human | 9088 | PKMYT1 | protein kinase, membrane as... | XM_011522734.3 | 99.5% | 99.3% | 4_9delCTAGAA |
| 3 | human | 9088 | PKMYT1 | protein kinase, membrane as... | XM_024450490.1 | 99.5% | 99.3% | 4_9delCTAGAA |
| 4 | human | 9088 | PKMYT1 | protein kinase, membrane as... | NM_001258451.2 | 98.5% | 98.5% | 0_1ins21 |
| 5 | human | 9088 | PKMYT1 | protein kinase, membrane as... | XM_011522735.3 | 98.5% | 98.5% | 0_1ins21 |
| 6 | human | 9088 | PKMYT1 | protein kinase, membrane as... | XM_011522736.3 | 98.5% | 98.5% | 0_1ins21 |
| 7 | human | 9088 | PKMYT1 | protein kinase, membrane as... | NM_182687.3 | 90.9% | 88.9% | 4_9delCTAGAA;1310_1347del;1440_1441ins95 |
| 8 | human | 9088 | PKMYT1 | protein kinase, membrane as... | NM_001258450.2 | 86.2% | 85.7% | (many diffs) |
| 9 | mouse | 268930 | Pkmyt1 | protein kinase, membrane as... | NM_023058.3 | 84.2% | 88.1% | (many diffs) |
| 10 | mouse | 268930 | Pkmyt1 | protein kinase, membrane as... | XM_006524310.2 | 78.6% | 82% | (many diffs) |
| 11 | mouse | 268930 | Pkmyt1 | protein kinase, membrane as... | XM_006524311.3 | 78% | 81.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1563
- ORF length:
- 1491
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgcggcct cctgcactgg ccatgcccat gcccacggag ggcaccccgc 121 cacctctgag tggcaccccc atcccagtcc cagcctactt ccgccacgca gaacctggat 181 tctccctcaa gaggcccagg gggctcagcc ggagcctccc acctccgccc cctgccaagg 241 gcagcattcc catcagccgc ctcttccctc ctcggacccc aggctggcac cagctgcagc 301 cccggcgggt gtcattccgg ggcgaggcct cagagactct gcagagccct gggtatgacc 361 caagccggcc agagtccttc ttccagcaga gcttccagag gctcagccgc ctgggccatg 421 gctcctacgg agaggtcttc aaggtgcgct ccaaggagga cggccggctc tatgcggtaa 481 agcgttccat gtcaccattc cggggcccca aggaccgggc ccgcaagttg gccgaggtgg 541 gcagccacga gaaggtgggg cagcacccat gctgcgtgcg gctggagcag gcctgggagg 601 agggcggcat cctgtacctg cagacggagc tgtgcgggcc cagcctgcag caacactgtg 661 aggcctgggg tgccagcctg cctgaggccc aggtctgggg ctacctgcgg gacacgctgc 721 ttgccctggc ccatctgcac agccagggcc tggtgcacct tgatgtcaag cctgccaaca 781 tcttcctggg gccccggggc cgctgcaagc tgggtgactt cggactgctg gtggagctgg 841 gtacagcagg agctggtgag gtccaggagg gagacccccg ctacatggcc cccgagctgc 901 tgcagggctc ctatgggaca gcagcggatg tgttcagtct gggcctcacc atcctggaag 961 tggcatgcaa catggagctg ccccacggtg gggagggctg gcagcagctg cgccagggct 1021 acctgccccc tgagttcact gccggtctgt cttccgagct gcgttctgtc cttgtcatga 1081 tgctggagcc agaccccaag ctgcgggcca cggccgaggc cctgctggca ctgcctgtgt 1141 tgaggcagcc gcgggcctgg ggtgtgctgt ggtgcatggc agcggaggcc ctgagccgag 1201 ggtgggccct gtggcaggcc ctgcttgccc tgctctgctg gcTCTGGCAT GGGCTGGCTC 1261 ACCCTGCCAG CTGGCTACAG CCCCTGGGCC CGCCAGCCAC CCCGCCTGGC TCACCACCCT 1321 GCAGTTTGCT CCTGGACAGC AGCCTCTCCA GCAACTGGGA TGACGACAGC CTAGGGCCTT 1381 CACTCTCCCC TGAGGCTGTC CTGGCCCGGA CTGTGGGGAG CACCTCCACC CCCCGGAGCA 1441 GGTGCACACC CAGGGATGCC CTGGACCTAA GTGACATCAA CTCAGAGCCT CCTCGGGGCT 1501 CCTTCCCCTC CTTTGAGCCT CGGAACCTCC TCAGCCTGTT TGAGGACACC CTAGACCCAA 1561 CCTGAGACCC AGCTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1621 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGCCCGTA ACTTGAAAGT ATTTCGATTT 1681 CTTGGCTTTA TATATCTTGT GGAAAGGACG ATATGGCCTA ATCTGGAGGT TGCCTACGCG 1741 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt