Construct: ORF TRCN0000488920
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF022002.1_s317c1
- DNA Barcode:
- CAATCAGCTAGGCTTACGTGGGGC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MAPT (4137)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488920
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4137 | MAPT | microtubule associated prot... | NM_001203252.1 | 100% | 100% | |
| 2 | human | 4137 | MAPT | microtubule associated prot... | NM_005910.5 | 92.9% | 92.9% | 823_915del |
| 3 | human | 4137 | MAPT | microtubule associated prot... | NM_001203251.2 | 92.9% | 92.9% | 218_219ins87 |
| 4 | human | 4137 | MAPT | microtubule associated prot... | NM_001123067.3 | 86.3% | 86.3% | 218_219ins87;736_828del |
| 5 | human | 4137 | MAPT | microtubule associated prot... | NM_016841.5 | 85.8% | 85.8% | 131_132ins174 |
| 6 | human | 4137 | MAPT | microtubule associated prot... | XM_005257369.4 | 80.8% | 80.8% | 426_623del;1021_1113del |
| 7 | human | 4137 | MAPT | microtubule associated prot... | NM_016834.5 | 79.8% | 79.8% | 131_132ins174;649_741del |
| 8 | human | 4137 | MAPT | microtubule associated prot... | XM_005257370.4 | 75.1% | 75.1% | 218_219ins87;339_536del;934_1026del |
| 9 | human | 4137 | MAPT | microtubule associated prot... | XM_005257371.4 | 69.4% | 69.4% | 131_132ins174;252_449del;847_939del |
| 10 | human | 4137 | MAPT | microtubule associated prot... | NM_016835.4 | 54% | 54% | 371_1123del;1179_1376del;1774_1866del |
| 11 | human | 4137 | MAPT | microtubule associated prot... | XM_005257368.4 | 53.5% | 53.5% | 371_1435del |
| 12 | human | 4137 | MAPT | microtubule associated prot... | NM_001123066.3 | 52.8% | 52.8% | (many diffs) |
| 13 | human | 4137 | MAPT | microtubule associated prot... | XM_005257367.4 | 51.5% | 51.5% | 371_1435del;1888_1980del |
| 14 | human | 4137 | MAPT | microtubule associated prot... | XM_005257365.4 | 49.3% | 49.3% | 371_1435del;1491_1688del |
| 15 | human | 4137 | MAPT | microtubule associated prot... | XM_005257366.3 | 49.2% | 45.6% | (many diffs) |
| 16 | human | 4137 | MAPT | microtubule associated prot... | XM_005257364.4 | 48.5% | 44.1% | (many diffs) |
| 17 | human | 4137 | MAPT | microtubule associated prot... | XM_005257362.4 | 47.5% | 47.5% | 371_1435del;1491_1688del;2086_2178del |
| 18 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532408.3 | 82.6% | 87.8% | (many diffs) |
| 19 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001038609.2 | 76.8% | 81.7% | (many diffs) |
| 20 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532409.2 | 76.4% | 81.5% | (many diffs) |
| 21 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532407.3 | 71.1% | 75.8% | (many diffs) |
| 22 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285456.1 | 70.8% | 75.7% | (many diffs) |
| 23 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285454.1 | 67% | 71.4% | (many diffs) |
| 24 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_010838.4 | 65.8% | 70.4% | (many diffs) |
| 25 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285455.1 | 61.7% | 66.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1299
- ORF length:
- 1230
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggctgagccc cgccaggagt tcgaagtgat ggaagatcac gctgggacgt 121 acgggttggg ggacaggaaa gatcaggggg gctacaccat gcaccaagac caagagggtg 181 acacggacgc tggcctgaaa gaatctcccc tgcagacccc cactgaggac ggatctgagg 241 aaccgggctc tgaaacctct gatgctaaga gcactccaac agcggaagat gtgacagcac 301 ccttagtgga tgagggagct cccggcaagc aggctgccgc gcagccccac acggagatcc 361 cagaaggaac cacagctgaa gaagcaggca ttggagacac ccccagcctg gaagacgaag 421 ctgctggtca cgtgacccaa gctcgcatgg tcagtaaaag caaagacggg actggaagcg 481 atgacaaaaa agccaagggg gctgatggta aaacgaagat cgccacaccg cggggagcag 541 cccctccagg ccagaagggc caggccaacg ccaccaggat tccagcaaaa accccgcccg 601 ctccaaagac accacccagc tctggtgaac ctccaaaatc aggggatcgc agcggctaca 661 gcagccccgg ctccccaggc actcccggca gccgctcccg caccccgtcc cttccaaccc 721 cacccacccg ggagcccaag aaggtggcag tggtccgtac tccacccaag tcgccgtctt 781 ccgccaagag ccgcctgcag acagcccccg tgcccatgcc agacctgaag aatgtcaagt 841 ccaagatcgg ctccactgag aacctgaagc accagccggg aggcgggaag gtgcaaatag 901 tctacaaacc agttgacctg agcaaggtga ccTCCAAGTG TGGCTCATTA GGCAACATCC 961 ATCATAAACC AGGAGGTGGC CAGGTGGAAG TAAAATCTGA GAAGCTTGAC TTCAAGGACA 1021 GAGTCCAGTC GAAGATTGGG TCCCTGGACA ATATCACCCA CGTCCCTGGC GGAGGAAATA 1081 AAAAGATTGA AACCCACAAG CTGACCTTCC GCGAGAACGC CAAAGCCAAG ACAGACCACG 1141 GGGCGGAGAT CGTGTACAAG TCGCCAGTGG TGTCTGGGGA CACGTCTCCA CGGCATCTCA 1201 GCAATGTCTC CTCCACCGGC AGCATCGACA TGGTAGACTC GCCCCAGCTC GCCACGCTAG 1261 CTGACGAGGT GTCTGCCTCC CTGGCCAAGC AGGGTTTGTG AGACCCAGCT TTCTTGTACA 1321 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1381 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1441 AGGACGACAA TCAGCTAGGC TTACGTGGGG CACGCGTTAA GTCgacaatc aacctctgga 1501 ttacaaaatt tgtgaaagat t