Construct: ORF TRCN0000488966
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021239.1_s317c1
- DNA Barcode:
- CCTGAATGTTCTTAAATATCAGAC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- ADK (132)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488966
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 132 | ADK | adenosine kinase | NM_006721.4 | 99.9% | 100% | 234T>C |
| 2 | human | 132 | ADK | adenosine kinase | NM_001123.3 | 94.8% | 94.1% | (many diffs) |
| 3 | human | 132 | ADK | adenosine kinase | NM_001202449.1 | 89.8% | 89.2% | (many diffs) |
| 4 | human | 132 | ADK | adenosine kinase | NM_001202450.1 | 84.1% | 84.2% | 234T>C;553_554ins171 |
| 5 | human | 132 | ADK | adenosine kinase | XM_017015698.1 | 84% | 81.4% | (many diffs) |
| 6 | human | 132 | ADK | adenosine kinase | NM_001369123.1 | 81.1% | 70.4% | 234T>C;760_761ins115;882_883ins89 |
| 7 | human | 132 | ADK | adenosine kinase | XM_017015699.1 | 79.5% | 73.3% | (many diffs) |
| 8 | human | 132 | ADK | adenosine kinase | NM_001369124.1 | 79% | 78.4% | (many diffs) |
| 9 | human | 132 | ADK | adenosine kinase | XM_017015702.1 | 76% | 64.7% | (many diffs) |
| 10 | human | 132 | ADK | adenosine kinase | XM_017015703.2 | 74.5% | 74.5% | 0_1ins276 |
| 11 | human | 132 | ADK | adenosine kinase | XM_017015704.1 | 67.4% | 66.8% | (many diffs) |
| 12 | human | 132 | ADK | adenosine kinase | XM_017015705.1 | 65.3% | 55% | (many diffs) |
| 13 | human | 132 | ADK | adenosine kinase | XM_017015706.1 | 62.3% | 61% | (many diffs) |
| 14 | mouse | 11534 | Adk | adenosine kinase | NM_134079.4 | 89.3% | 91.4% | (many diffs) |
| 15 | mouse | 11534 | Adk | adenosine kinase | NM_001243041.1 | 83.7% | 86.1% | (many diffs) |
| 16 | mouse | 11534 | Adk | adenosine kinase | XM_006518440.3 | 63.3% | 61.5% | (many diffs) |
| 17 | mouse | 11534 | Adk | adenosine kinase | XM_006518441.3 | 59.7% | 61.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 59
- ORF end:
- 1145
- ORF length:
- 1086
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaccat 61 ggcagctgct gaggaggagc cgaagcccaa aaagctgaag gtggaggcgc cgcaagcgct 121 gagagaaaat attctctttg gaatgggaaa tcctctgctt gacatctctg ctgtagtgga 181 caaagatttc cttgataagt attctctgaa accaaatgac caaatcttgg ctgaagacaa 241 acacaaggaa ctgtttgatg aacttgtgaa aaaattcaaa gtcgaatatc acgctggtgg 301 ctctacccag aattcaatta aagtggctca gtggatgatt caacagccac acaaagcagc 361 aacatttttt ggatgcattg ggatagataa atttggggag atcctgaaga gaaaagctgc 421 tgaagcccat gtggatgctc attactacga gcagaatgag cagccaacag gaacttgtgc 481 tgcatgcatc actggtgaca acaggtccct catagctaat cttgctgctg ccaattgtta 541 taaaaaggaa aaacatcttg atctggagaa aaactggatg ttggtagaaa aagcaagagt 601 ttgttatata gcaggctttt ttcttacagt ttccccagag tcagtattaa aggtggctca 661 ccatgcttct gaaaacaaca ggattttcac tttgaatcta tctgcaccgt ttattagcca 721 gttctacaag gaatcattga tgaaagttat gccttatgtt GATATACTTT TTGGAAATGA 781 GACAGAAGCT GCCACTTTTG CTAGAGAGCA AGGCTTTGAG ACTAAAGACA TTAAAGAGAT 841 AGCCAAAAAG ACACAAGCCC TGCCAAAGAT GAACTCAAAG AGGCAGCGAA TCGTGATCTT 901 CACCCAAGGG AGAGATGACA CTATAATGGC TACAGAAAGT GAAGTCACTG CTTTTGCTGT 961 CTTGGATCAA GACCAGAAAG AAATTATTGA TACCAATGGA GCTGGAGATG CATTTGTTGG 1021 AGGTTTTCTG TCTCAACTGG TCTCTGACAA GCCTCTGACT GAATGTATCC GTGCTGGCCA 1081 CTATGCAGCA AGCATCATAA TTAGACGGAC TGGCTGCACC TTTCCTGAGA AGCCAGACTT 1141 CCACTGAGAC CCAGCTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC 1201 TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT 1261 TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACCTGAAT GTTCTTAAAT ATCAGACACG 1321 CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt