Transcript: Mouse XM_006518440.3

PREDICTED: Mus musculus adenosine kinase (Adk), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adk (11534)
Length:
989
CDS:
65..853

Additional Resources:

NCBI RefSeq record:
XM_006518440.3
NBCI Gene record:
Adk (11534)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006518440.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024735 GCCGCCAATTGTTACAAGAAA pLKO.1 530 CDS 100% 5.625 7.875 N Adk n/a
2 TRCN0000280477 GCCGCCAATTGTTACAAGAAA pLKO_005 530 CDS 100% 5.625 7.875 N Adk n/a
3 TRCN0000024737 GTATTGAAAGTGGCTCGCTAT pLKO.1 647 CDS 100% 4.050 5.670 N Adk n/a
4 TRCN0000280479 GTATTGAAAGTGGCTCGCTAT pLKO_005 647 CDS 100% 4.050 5.670 N Adk n/a
5 TRCN0000196377 GACAAAGATTTCCTTGATAAG pLKO.1 182 CDS 100% 10.800 8.640 N ADK n/a
6 TRCN0000024736 CCTTGATAAGTATTCTCTGAA pLKO.1 193 CDS 100% 4.950 3.465 N Adk n/a
7 TRCN0000280539 CCTTGATAAGTATTCTCTGAA pLKO_005 193 CDS 100% 4.950 3.465 N Adk n/a
8 TRCN0000010076 ATATCATGCTGGTGGCTCTAC pLKO.1 289 CDS 100% 4.050 2.835 N ADK n/a
9 TRCN0000315254 ATATCATGCTGGTGGCTCTAC pLKO_005 289 CDS 100% 4.050 2.835 N ADK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006518440.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05779 pDONR223 98.8% 59% 56.1% None (many diffs) n/a
2 ccsbBroad304_05779 pLX_304 0% 59% 56.1% V5 (many diffs) n/a
3 TRCN0000475294 AGTGCCTGACGGAGGTTCGTGGCG pLX_317 53.1% 55.6% 39.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488966 CCTGAATGTTCTTAAATATCAGAC pLX_317 36.1% 63.3% 61.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488487 CCACACGCATTACAACTTATGGTG pLX_317 31% 59% 56.1% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000487814 ACCAATCACTTAAGGCCTCATGAG pLX_317 19.7% 59% 56.3% V5 (many diffs) n/a
Download CSV