Transcript: Human NM_001369123.1

Homo sapiens adenosine kinase (ADK), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
ADK (132)
Length:
1877
CDS:
59..943

Additional Resources:

NCBI RefSeq record:
NM_001369123.1
NBCI Gene record:
ADK (132)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147557 GTAGTAATGAGCATCCACAT pXPR_003 GGG 373 42% 5 1.2905 ADK ADK 75745
2 BRDN0001146463 TCTGGAGAAAAACTGGATGT pXPR_003 TGG 520 59% 6 0.649 ADK ADK 75742
3 BRDN0001146410 ACAGCAGAGATGTCAAGCAG pXPR_003 AGG 99 11% 2 0.4644 ADK ADK 75743
4 BRDN0001146622 AAAGTCGAATATCATGCTGG pXPR_003 TGG 236 27% 4 0.1955 ADK ADK 75744
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315187 ATCTATCTGCACCGTTTATTA pLKO_005 696 CDS 100% 15.000 21.000 N ADK n/a
2 TRCN0000010078 GTCAGTATTAAAGGTGGCTCA pLKO.1 640 CDS 100% 2.160 1.728 N ADK n/a
3 TRCN0000379900 ATACACCTGATAGTCAAATAA pLKO_005 1509 3UTR 100% 15.000 10.500 N ADK n/a
4 TRCN0000315188 CTATGCAGCAAGCATCATAAT pLKO_005 966 3UTR 100% 13.200 9.240 N ADK n/a
5 TRCN0000194650 CTCTTTAATGTGCACTCAAAC pLKO.1 1568 3UTR 100% 10.800 7.560 N ADK n/a
6 TRCN0000196377 GACAAAGATTTCCTTGATAAG pLKO.1 179 CDS 100% 10.800 7.560 N ADK n/a
7 TRCN0000024736 CCTTGATAAGTATTCTCTGAA pLKO.1 190 CDS 100% 4.950 3.465 N Adk n/a
8 TRCN0000280539 CCTTGATAAGTATTCTCTGAA pLKO_005 190 CDS 100% 4.950 3.465 N Adk n/a
9 TRCN0000010076 ATATCATGCTGGTGGCTCTAC pLKO.1 286 CDS 100% 4.050 2.835 N ADK n/a
10 TRCN0000315254 ATATCATGCTGGTGGCTCTAC pLKO_005 286 CDS 100% 4.050 2.835 N ADK n/a
11 TRCN0000010077 GAGCAGAATGAGCAGCCAACA pLKO.1 449 CDS 100% 4.050 2.835 N ADK n/a
12 TRCN0000315185 GAGCAGAATGAGCAGCCAACA pLKO_005 449 CDS 100% 4.050 2.835 N ADK n/a
13 TRCN0000315186 GCCACTTAAATGCCAATTAAA pLKO_005 1249 3UTR 100% 15.000 9.000 N ADK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369123.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488966 CCTGAATGTTCTTAAATATCAGAC pLX_317 36.1% 81.1% 70.4% V5 (not translated due to prior stop codon) 234T>C;760_761ins115;882_883ins89 n/a
2 ccsbBroadEn_05779 pDONR223 98.8% 76% 64.4% None (many diffs) n/a
3 ccsbBroad304_05779 pLX_304 0% 76% 64.4% V5 (many diffs) n/a
4 TRCN0000475294 AGTGCCTGACGGAGGTTCGTGGCG pLX_317 53.1% 59.2% 37% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488487 CCACACGCATTACAACTTATGGTG pLX_317 31% 76% 64.4% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000487814 ACCAATCACTTAAGGCCTCATGAG pLX_317 19.7% 75.9% 64.5% V5 (many diffs) n/a
Download CSV