Transcript: Human XM_017015705.1

PREDICTED: Homo sapiens adenosine kinase (ADK), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADK (132)
Length:
1752
CDS:
95..808

Additional Resources:

NCBI RefSeq record:
XM_017015705.1
NBCI Gene record:
ADK (132)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147557 GTAGTAATGAGCATCCACAT pXPR_003 GGG 373 52% 5 1.2813 ADK ADK 75745
2 BRDN0001146463 TCTGGAGAAAAACTGGATGT pXPR_003 TGG 520 73% 6 0.5324 ADK ADK 75742
3 BRDN0001146410 ACAGCAGAGATGTCAAGCAG pXPR_003 AGG 99 14% 2 0.4403 ADK ADK 75743
4 BRDN0001146622 AAAGTCGAATATCATGCTGG pXPR_003 TGG 236 33% 4 0.1901 ADK ADK 75744
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017015705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379900 ATACACCTGATAGTCAAATAA pLKO_005 1374 3UTR 100% 15.000 10.500 N ADK n/a
2 TRCN0000315188 CTATGCAGCAAGCATCATAAT pLKO_005 831 3UTR 100% 13.200 9.240 N ADK n/a
3 TRCN0000194650 CTCTTTAATGTGCACTCAAAC pLKO.1 1433 3UTR 100% 10.800 7.560 N ADK n/a
4 TRCN0000196377 GACAAAGATTTCCTTGATAAG pLKO.1 215 CDS 100% 10.800 7.560 N ADK n/a
5 TRCN0000024736 CCTTGATAAGTATTCTCTGAA pLKO.1 226 CDS 100% 4.950 3.465 N Adk n/a
6 TRCN0000280539 CCTTGATAAGTATTCTCTGAA pLKO_005 226 CDS 100% 4.950 3.465 N Adk n/a
7 TRCN0000010076 ATATCATGCTGGTGGCTCTAC pLKO.1 322 CDS 100% 4.050 2.835 N ADK n/a
8 TRCN0000315254 ATATCATGCTGGTGGCTCTAC pLKO_005 322 CDS 100% 4.050 2.835 N ADK n/a
9 TRCN0000010077 GAGCAGAATGAGCAGCCAACA pLKO.1 485 CDS 100% 4.050 2.835 N ADK n/a
10 TRCN0000315185 GAGCAGAATGAGCAGCCAACA pLKO_005 485 CDS 100% 4.050 2.835 N ADK n/a
11 TRCN0000315186 GCCACTTAAATGCCAATTAAA pLKO_005 1114 3UTR 100% 15.000 9.000 N ADK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017015705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05779 pDONR223 98.8% 60.4% 49.3% None (many diffs) n/a
2 ccsbBroad304_05779 pLX_304 0% 60.4% 49.3% V5 (many diffs) n/a
3 TRCN0000475294 AGTGCCTGACGGAGGTTCGTGGCG pLX_317 53.1% 60.1% 45.9% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488966 CCTGAATGTTCTTAAATATCAGAC pLX_317 36.1% 65.3% 55% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488487 CCACACGCATTACAACTTATGGTG pLX_317 31% 60.4% 49.3% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000487814 ACCAATCACTTAAGGCCTCATGAG pLX_317 19.7% 60.2% 49.1% V5 (many diffs) n/a
Download CSV