Transcript: Human NM_001202449.1

Homo sapiens adenosine kinase (ADK), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
ADK (132)
Length:
2234
CDS:
385..1368

Additional Resources:

NCBI RefSeq record:
NM_001202449.1
NBCI Gene record:
ADK (132)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001202449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315187 ATCTATCTGCACCGTTTATTA pLKO_005 917 CDS 100% 15.000 21.000 N ADK n/a
2 TRCN0000010078 GTCAGTATTAAAGGTGGCTCA pLKO.1 861 CDS 100% 2.160 1.728 N ADK n/a
3 TRCN0000382207 AGGGAGAGATGACACTATAAT pLKO_005 1128 CDS 100% 15.000 10.500 N ADK n/a
4 TRCN0000379900 ATACACCTGATAGTCAAATAA pLKO_005 1845 3UTR 100% 15.000 10.500 N ADK n/a
5 TRCN0000315188 CTATGCAGCAAGCATCATAAT pLKO_005 1302 CDS 100% 13.200 9.240 N ADK n/a
6 TRCN0000194650 CTCTTTAATGTGCACTCAAAC pLKO.1 1904 3UTR 100% 10.800 7.560 N ADK n/a
7 TRCN0000196377 GACAAAGATTTCCTTGATAAG pLKO.1 454 CDS 100% 10.800 7.560 N ADK n/a
8 TRCN0000010080 GACACTATAATGGCTACAGAA pLKO.1 1138 CDS 100% 4.950 3.465 N ADK n/a
9 TRCN0000010076 ATATCATGCTGGTGGCTCTAC pLKO.1 507 CDS 100% 4.050 2.835 N ADK n/a
10 TRCN0000315254 ATATCATGCTGGTGGCTCTAC pLKO_005 507 CDS 100% 4.050 2.835 N ADK n/a
11 TRCN0000010079 GACATTAAAGAGATAGCCAAA pLKO.1 1048 CDS 100% 4.050 2.835 N ADK n/a
12 TRCN0000010077 GAGCAGAATGAGCAGCCAACA pLKO.1 670 CDS 100% 4.050 2.835 N ADK n/a
13 TRCN0000315185 GAGCAGAATGAGCAGCCAACA pLKO_005 670 CDS 100% 4.050 2.835 N ADK n/a
14 TRCN0000315186 GCCACTTAAATGCCAATTAAA pLKO_005 1585 3UTR 100% 15.000 9.000 N ADK n/a
15 TRCN0000024734 GCTTTGAGACTAAAGACATTA pLKO.1 1034 CDS 100% 13.200 7.920 N Adk n/a
16 TRCN0000297856 GCTTTGAGACTAAAGACATTA pLKO_005 1034 CDS 100% 13.200 7.920 N Adk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001202449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05779 pDONR223 98.8% 94.6% 94.4% None 89_90ins54;550A>T n/a
2 ccsbBroad304_05779 pLX_304 0% 94.6% 94.4% V5 89_90ins54;550A>T n/a
3 TRCN0000475294 AGTGCCTGACGGAGGTTCGTGGCG pLX_317 53.1% 48.3% 27.5% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000488487 CCACACGCATTACAACTTATGGTG pLX_317 31% 94.6% 94.4% V5 (not translated due to prior stop codon) 89_90ins54;550A>T n/a
5 TRCN0000487814 ACCAATCACTTAAGGCCTCATGAG pLX_317 19.7% 94.5% 94.5% V5 89_90ins54;102T>C;981_982insG n/a
6 TRCN0000488966 CCTGAATGTTCTTAAATATCAGAC pLX_317 36.1% 89.8% 89.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV