Transcript: Mouse XM_006511920.2

PREDICTED: Mus musculus oxidative-stress responsive 1 (Oxsr1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Oxsr1 (108737)
Length:
4109
CDS:
398..1405

Additional Resources:

NCBI RefSeq record:
XM_006511920.2
NBCI Gene record:
Oxsr1 (108737)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511920.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025325 GCAGCTCCTTATCATAAATAT pLKO.1 491 CDS 100% 15.000 21.000 N Oxsr1 n/a
2 TRCN0000319753 GCAGCTCCTTATCATAAATAT pLKO_005 491 CDS 100% 15.000 21.000 N Oxsr1 n/a
3 TRCN0000025326 GATGGCAAACTGATAGGATTT pLKO.1 1364 CDS 100% 10.800 15.120 N Oxsr1 n/a
4 TRCN0000319754 GATGGCAAACTGATAGGATTT pLKO_005 1364 CDS 100% 10.800 15.120 N Oxsr1 n/a
5 TRCN0000025328 GCTAAGATTAAGGAATTCCAA pLKO.1 1132 CDS 100% 0.000 0.000 N Oxsr1 n/a
6 TRCN0000350179 GCTAAGATTAAGGAATTCCAA pLKO_005 1132 CDS 100% 0.000 0.000 N Oxsr1 n/a
7 TRCN0000025324 CCTGCATAAGAATGGGCAGAT pLKO.1 229 5UTR 100% 4.050 2.835 N Oxsr1 n/a
8 TRCN0000025327 GTGGTGACATTACCAGAAATA pLKO.1 342 5UTR 100% 13.200 7.920 N Oxsr1 n/a
9 TRCN0000319752 GTGGTGACATTACCAGAAATA pLKO_005 342 5UTR 100% 13.200 7.920 N Oxsr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511920.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14949 pDONR223 0% 57.6% 59.7% None (many diffs) n/a
2 ccsbBroad304_14949 pLX_304 0% 57.6% 59.7% V5 (many diffs) n/a
3 TRCN0000468244 TGCTCTTTCACGCTGTCTCTGAAC pLX_317 25.8% 57.6% 59.7% V5 (many diffs) n/a
4 TRCN0000489498 AGAGCAACCAAATGCAAACTATGA pLX_317 25.9% 57.6% 59.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV