Transcript: Mouse NM_133985.2

Mus musculus oxidative-stress responsive 1 (Oxsr1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Oxsr1 (108737)
Length:
4647
CDS:
354..1937

Additional Resources:

NCBI RefSeq record:
NM_133985.2
NBCI Gene record:
Oxsr1 (108737)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133985.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234391 AGGTTCTGTTCTGGATATTAT pLKO_005 644 CDS 100% 15.000 21.000 N OXSR1 n/a
2 TRCN0000025325 GCAGCTCCTTATCATAAATAT pLKO.1 1023 CDS 100% 15.000 21.000 N Oxsr1 n/a
3 TRCN0000319753 GCAGCTCCTTATCATAAATAT pLKO_005 1023 CDS 100% 15.000 21.000 N Oxsr1 n/a
4 TRCN0000025326 GATGGCAAACTGATAGGATTT pLKO.1 1896 CDS 100% 10.800 15.120 N Oxsr1 n/a
5 TRCN0000319754 GATGGCAAACTGATAGGATTT pLKO_005 1896 CDS 100% 10.800 15.120 N Oxsr1 n/a
6 TRCN0000025328 GCTAAGATTAAGGAATTCCAA pLKO.1 1664 CDS 100% 0.000 0.000 N Oxsr1 n/a
7 TRCN0000350179 GCTAAGATTAAGGAATTCCAA pLKO_005 1664 CDS 100% 0.000 0.000 N Oxsr1 n/a
8 TRCN0000025324 CCTGCATAAGAATGGGCAGAT pLKO.1 761 CDS 100% 4.050 2.835 N Oxsr1 n/a
9 TRCN0000025327 GTGGTGACATTACCAGAAATA pLKO.1 874 CDS 100% 13.200 7.920 N Oxsr1 n/a
10 TRCN0000319752 GTGGTGACATTACCAGAAATA pLKO_005 874 CDS 100% 13.200 7.920 N Oxsr1 n/a
11 TRCN0000010643 GTGGAGGTTCTGTTCTGGATA pLKO.1 640 CDS 100% 4.950 2.970 N OXSR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133985.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14949 pDONR223 0% 90.5% 95.8% None (many diffs) n/a
2 ccsbBroad304_14949 pLX_304 0% 90.5% 95.8% V5 (many diffs) n/a
3 TRCN0000468244 TGCTCTTTCACGCTGTCTCTGAAC pLX_317 25.8% 90.5% 95.8% V5 (many diffs) n/a
4 TRCN0000489498 AGAGCAACCAAATGCAAACTATGA pLX_317 25.9% 90.5% 95.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV