Construct: ORF TRCN0000489514
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021532.1_s317c1
- DNA Barcode:
- ATGGGGGTCTATGAAACTGGAGAA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- MAPT (4137)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489514
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4137 | MAPT | microtubule associated prot... | NM_001123067.3 | 99.9% | 99.7% | 1129C>T |
| 2 | human | 4137 | MAPT | microtubule associated prot... | NM_005910.5 | 93.3% | 93.1% | 219_305del;1216C>T |
| 3 | human | 4137 | MAPT | microtubule associated prot... | NM_016834.5 | 92.8% | 92.7% | 130_131ins87;1042C>T |
| 4 | human | 4137 | MAPT | microtubule associated prot... | NM_001203251.2 | 92.3% | 92.2% | 735_736ins93;1036C>T |
| 5 | human | 4137 | MAPT | microtubule associated prot... | NM_001203252.1 | 86.3% | 86.1% | 219_305del;822_823ins93;1123C>T |
| 6 | human | 4137 | MAPT | microtubule associated prot... | XM_005257370.4 | 86.1% | 85.9% | 339_536del;1327C>T |
| 7 | human | 4137 | MAPT | microtubule associated prot... | NM_016841.5 | 85.3% | 85.1% | 130_131ins87;648_649ins93;949C>T |
| 8 | human | 4137 | MAPT | microtubule associated prot... | XM_005257369.4 | 81.1% | 81% | 219_305del;426_623del;1414C>T |
| 9 | human | 4137 | MAPT | microtubule associated prot... | XM_005257371.4 | 80% | 79.9% | 130_131ins87;252_449del;1240C>T |
| 10 | human | 4137 | MAPT | microtubule associated prot... | NM_016835.4 | 54.3% | 54.2% | (many diffs) |
| 11 | human | 4137 | MAPT | microtubule associated prot... | NM_001123066.3 | 53% | 52.9% | (many diffs) |
| 12 | human | 4137 | MAPT | microtubule associated prot... | XM_005257367.4 | 51.7% | 51.6% | 219_305del;371_1435del;2281C>T |
| 13 | human | 4137 | MAPT | microtubule associated prot... | XM_005257366.3 | 50.6% | 45.8% | (many diffs) |
| 14 | human | 4137 | MAPT | microtubule associated prot... | XM_005257364.4 | 49.4% | 49.3% | 284_1348del;1404_1601del;2392C>T |
| 15 | human | 4137 | MAPT | microtubule associated prot... | XM_005257368.4 | 47.8% | 47.7% | (many diffs) |
| 16 | human | 4137 | MAPT | microtubule associated prot... | XM_005257362.4 | 47.7% | 47.6% | (many diffs) |
| 17 | human | 4137 | MAPT | microtubule associated prot... | XM_005257365.4 | 44.1% | 44% | (many diffs) |
| 18 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532407.3 | 83.2% | 88.4% | (many diffs) |
| 19 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001038609.2 | 77.8% | 82.6% | (many diffs) |
| 20 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_010838.4 | 77.6% | 82.6% | (many diffs) |
| 21 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532409.2 | 76% | 80.9% | (many diffs) |
| 22 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285455.1 | 73.2% | 78% | (many diffs) |
| 23 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532408.3 | 71% | 75.6% | (many diffs) |
| 24 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285456.1 | 70.3% | 75.1% | (many diffs) |
| 25 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285454.1 | 66.6% | 70.9% | (many diffs) |
| 26 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532410.3 | 44.8% | 47.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1305
- ORF length:
- 1236
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggctgagccc cgccaggagt tcgaagtgat ggaagatcac gctgggacgt 121 acgggttggg ggacaggaaa gatcaggggg gctacaccat gcaccaagac caagagggtg 181 acacggacgc tggcctgaaa gaatctcccc tgcagacccc cactgaggac ggatctgagg 241 aaccgggctc tgaaacctct gatgctaaga gcactccaac agcggaagct gaagaagcag 301 gcattggaga cacccccagc ctggaagacg aagctgctgg tcacgtgacc caagctcgca 361 tggtcagtaa aagcaaagac gggactggaa gcgatgacaa aaaagccaag ggggctgatg 421 gtaaaacgaa gatcgccaca ccgcggggag cagcccctcc aggccagaag ggccaggcca 481 acgccaccag gattccagca aaaaccccgc ccgctccaaa gacaccaccc agctctggtg 541 aacctccaaa atcaggggat cgcagcggct acagcagccc cggctcccca ggcactcccg 601 gcagccgctc ccgcaccccg tcccttccaa ccccacccac ccgggagccc aagaaggtgg 661 cagtggtccg tactccaccc aagtcgccgt cttccgccaa gagccgcctg cagacagccc 721 ccgtgcccat gccagacctg aagaatgtca agtccaagat cggctccact gagaacctga 781 agcaccagcc gggaggcggg aaggtgcaga taattaataa gaagctggat cttagcaacg 841 tccagtccaa gtgtggctca aaggataata tcaaacacgt cccgggaggc ggcagtgtgc 901 aaatagtcta caaaccagtt gacctgagca aggtgacctc caagtgtggc tcattaggca 961 acatccatca tAAACCAGGA GGTGGCCAGG TGGAAGTAAA ATCTGAGAAG CTTGACTTCA 1021 AGGACAGAGT CCAGTCGAAG ATTGGGTCCC TGGACAATAT CACCCACGTC CCTGGCGGAG 1081 GAAATAAAAA GATTGAAACC CACAAGCTGA CCTTCCGCGA GAACGCCAAA GCCAAGACAG 1141 ACCACGGGGC GGAGATCGTG TACAAGTCGC CAGTGGTGTC TGGGGACACG TCTCCATGGC 1201 ATCTCAGCAA TGTCTCCTCC ACCGGCAGCA TCGACATGGT AGACTCGCCC CAGCTCGCCA 1261 CGCTAGCTGA CGAGGTGTCT GCCTCCCTGG CCAAGCAGGG TTTGTGAGAC CCAGCTTTCT 1321 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1381 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1441 GTGGAAAGGA CGAATGGGGG TCTATGAAAC TGGAGAAACG CGTTAAGTCg acaatcaacc 1501 tctggattac aaaatttgtg aaagatt