Construct: ORF TRCN0000489653
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019928.1_s317c1
- DNA Barcode:
- TCATCCCTTTTTCTTCACCTTATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MAPT (4137)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489653
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4137 | MAPT | microtubule associated prot... | NM_001203251.2 | 99.9% | 99.7% | 1143_1144insG |
| 2 | human | 4137 | MAPT | microtubule associated prot... | NM_001203252.1 | 92.8% | 92.7% | 219_305del;1230_1231insG |
| 3 | human | 4137 | MAPT | microtubule associated prot... | NM_001123067.3 | 92.4% | 92.2% | 736_828del;1236_1237insG |
| 4 | human | 4137 | MAPT | microtubule associated prot... | NM_016841.5 | 92.3% | 92.1% | 130_131ins87;1056_1057insG |
| 5 | human | 4137 | MAPT | microtubule associated prot... | NM_005910.5 | 86.3% | 86.1% | 219_305del;823_915del;1323_1324insG |
| 6 | human | 4137 | MAPT | microtubule associated prot... | NM_016834.5 | 85.3% | 85.2% | 130_131ins87;649_741del;1149_1150insG |
| 7 | human | 4137 | MAPT | microtubule associated prot... | XM_005257370.4 | 79.6% | 79.5% | 339_536del;934_1026del;1434_1435insG |
| 8 | human | 4137 | MAPT | microtubule associated prot... | XM_005257369.4 | 75% | 75% | (many diffs) |
| 9 | human | 4137 | MAPT | microtubule associated prot... | XM_005257371.4 | 73.5% | 73.4% | (many diffs) |
| 10 | human | 4137 | MAPT | microtubule associated prot... | NM_016835.4 | 50.2% | 50.1% | (many diffs) |
| 11 | human | 4137 | MAPT | microtubule associated prot... | XM_005257368.4 | 49.7% | 49.7% | 219_305del;371_1435del;2295_2296insG |
| 12 | human | 4137 | MAPT | microtubule associated prot... | NM_001123066.3 | 49% | 49% | (many diffs) |
| 13 | human | 4137 | MAPT | microtubule associated prot... | XM_005257367.4 | 47.8% | 47.8% | (many diffs) |
| 14 | human | 4137 | MAPT | microtubule associated prot... | XM_005257366.3 | 46.7% | 42.2% | (many diffs) |
| 15 | human | 4137 | MAPT | microtubule associated prot... | XM_005257365.4 | 45.8% | 45.7% | (many diffs) |
| 16 | human | 4137 | MAPT | microtubule associated prot... | XM_005257364.4 | 45.7% | 45.6% | (many diffs) |
| 17 | human | 4137 | MAPT | microtubule associated prot... | XM_005257362.4 | 44.1% | 44.1% | (many diffs) |
| 18 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532409.2 | 82.1% | 87.5% | (many diffs) |
| 19 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532408.3 | 76.4% | 81.3% | (many diffs) |
| 20 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285456.1 | 76.1% | 81.2% | (many diffs) |
| 21 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532407.3 | 76% | 80.9% | (many diffs) |
| 22 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285454.1 | 71.9% | 76.6% | (many diffs) |
| 23 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001038609.2 | 71% | 75.6% | (many diffs) |
| 24 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_010838.4 | 70.4% | 75.1% | (many diffs) |
| 25 | mouse | 17762 | Mapt | microtubule-associated prot... | NM_001285455.1 | 65.9% | 70.6% | (many diffs) |
| 26 | mouse | 17762 | Mapt | microtubule-associated prot... | XM_006532410.3 | 41% | 43.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1215
- ORF length:
- 1146
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat ggctgagccc cgccaggagt tcgaagtgat ggaagatcac gctgggacgt 121 acgggttggg ggacaggaaa gatcaggggg gctacaccat gcaccaagac caagagggtg 181 acacggacgc tggcctgaaa gaatctcccc tgcagacccc cactgaggac ggatctgagg 241 aaccgggctc tgaaacctct gatgctaaga gcactccaac agcggaagct gaagaagcag 301 gcattggaga cacccccagc ctggaagacg aagctgctgg tcacgtgacc caagctcgca 361 tggtcagtaa aagcaaagac gggactggaa gcgatgacaa aaaagccaag ggggctgatg 421 gtaaaacgaa gatcgccaca ccgcggggag cagcccctcc aggccagaag ggccaggcca 481 acgccaccag gattccagca aaaaccccgc ccgctccaaa gacaccaccc agctctggtg 541 aacctccaaa atcaggggat cgcagcggct acagcagccc cggctcccca ggcactcccg 601 gcagccgctc ccgcaccccg tcccttccaa ccccacccac ccgggagccc aagaaggtgg 661 cagtggtccg tactccaccc aagtcgccgt cttccgccaa gagccgcctg cagacagccc 721 ccgtgcccat gccagacctg aagaatgtca agtccaagat cggctccact gagaacctga 781 agcaccagcc gggaggcggg aaggtgcaaa tagtctacaa accagttgac ctGAGCAAGG 841 TGACCTCCAA GTGTGGCTCA TTAGGCAACA TCCATCATAA ACCAGGAGGT GGCCAGGTGG 901 AAGTAAAATC TGAGAAGCTT GACTTCAAGG ACAGAGTCCA GTCGAAGATT GGGTCCCTGG 961 ACAATATCAC CCACGTCCCT GGCGGAGGAA ATAAAAAGAT TGAAACCCAC AAGCTGACCT 1021 TCCGCGAGAA CGCCAAAGCC AAGACAGACC ACGGGGCGGA GATCGTGTAC AAGTCGCCAG 1081 TGGTGTCTGG GGACACGTCT CCACGGCATC TCAGCAATGT CTCCTCCACC GGCAGCATCG 1141 ACATGGTAGA CTCGCCCCAG CTCGCCACGC TAGCTGACGA GGTGTCTGCC TCCCTGGCCA 1201 AGCAGGGTTT GGACCCAGCT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1261 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1321 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATCA TCCCTTTTTC TTCACCTTAT 1381 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t