Construct: ORF TRCN0000491865
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004455.1_s317c1
- Derived from:
- ccsbBroadEn_13699
- DNA Barcode:
- TCAAGTGTCGATCAACATATTAAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPDYE2 (441273)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000491865
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 285955 | SPDYE1 | speedy/RINGO cell cycle reg... | XM_017012016.2 | 75.9% | 74.2% | (many diffs) |
2 | human | 285955 | SPDYE1 | speedy/RINGO cell cycle reg... | XM_017012017.2 | 71.3% | 62.1% | (many diffs) |
3 | human | 441273 | SPDYE2 | speedy/RINGO cell cycle reg... | NM_001031618.3 | 64% | 63.9% | 1_432del;860C>G |
4 | human | 100310812 | SPDYE2B | speedy/RINGO cell cycle reg... | NM_001166339.1 | 64% | 63.9% | 1_432del;860C>G |
5 | human | 100310812 | SPDYE2B | speedy/RINGO cell cycle reg... | XM_005250093.4 | 64% | 63.9% | 1_432del;860C>G |
6 | human | 441273 | SPDYE2 | speedy/RINGO cell cycle reg... | XM_017012223.1 | 64% | 63.9% | 1_432del;860C>G |
7 | human | 729597 | SPDYE6 | speedy/RINGO cell cycle reg... | NM_001146210.4 | 64% | 63.9% | 1_432del;708T>C;1010A>G |
8 | human | 442590 | SPDYE5 | speedy/RINGO cell cycle reg... | NM_001306141.1 | 62.9% | 61.9% | (many diffs) |
9 | human | 285955 | SPDYE1 | speedy/RINGO cell cycle reg... | NM_175064.2 | 62.7% | 61.3% | (many diffs) |
10 | human | 100310812 | SPDYE2B | speedy/RINGO cell cycle reg... | XM_011515702.3 | 60.5% | 58.9% | (many diffs) |
11 | human | 441273 | SPDYE2 | speedy/RINGO cell cycle reg... | XM_011516237.3 | 60.5% | 58.9% | (many diffs) |
12 | human | 100996746 | SPDYE11 | speedy/RINGO cell cycle reg... | XM_024446630.1 | 60% | 41.6% | (many diffs) |
13 | human | 100996746 | SPDYE11 | speedy/RINGO cell cycle reg... | NM_001351349.1 | 59% | 54.2% | (many diffs) |
14 | human | 102723849 | SPDYE17 | speedy/RINGO cell cycle reg... | NM_001351351.1 | 59% | 54.2% | (many diffs) |
15 | human | 100505767 | SPDYE18 | speedy/RINGO cell cycle reg... | NM_001351348.1 | 57.7% | 52.5% | (many diffs) |
16 | human | 285955 | SPDYE1 | speedy/RINGO cell cycle reg... | XM_005249719.3 | 56.4% | 55.2% | (many diffs) |
17 | human | 285955 | SPDYE1 | speedy/RINGO cell cycle reg... | XM_017012015.1 | 56.4% | 55.2% | (many diffs) |
18 | human | 102723555 | SPDYE16 | speedy/RINGO cell cycle reg... | NM_001351597.1 | 55.5% | 52.4% | (many diffs) |
19 | human | 102723555 | SPDYE16 | speedy/RINGO cell cycle reg... | XM_017012887.2 | 55.5% | 52.4% | (many diffs) |
20 | human | 388333 | SPDYE4 | speedy/RINGO cell cycle reg... | NM_001128076.3 | 51% | 44.2% | (many diffs) |
21 | human | 388333 | SPDYE4 | speedy/RINGO cell cycle reg... | XM_005256633.4 | 51% | 44.2% | (many diffs) |
22 | human | 441251 | SPDYE7P | speedy/RINGO cell cycle reg... | NR_003666.2 | 49.9% | (many diffs) | |
23 | human | 441272 | SPDYE3 | speedy/RINGO cell cycle reg... | XM_011516234.3 | 32.3% | 23.7% | (many diffs) |
24 | human | 441272 | SPDYE3 | speedy/RINGO cell cycle reg... | XM_011516235.3 | 32.3% | 23.7% | (many diffs) |
25 | human | 441272 | SPDYE3 | speedy/RINGO cell cycle reg... | NM_001004351.5 | 31.4% | 28.6% | (many diffs) |
26 | human | 641776 | SPDYE14P | speedy/RINGO cell cycle reg... | NR_146072.1 | 22.6% | (many diffs) | |
27 | human | 105180390 | SPDYE13P | speedy/RINGO cell cycle reg... | NR_146073.1 | 22.6% | (many diffs) | |
28 | human | 105180391 | SPDYE15P | speedy/RINGO cell cycle reg... | NR_146074.1 | 22.6% | (many diffs) | |
29 | human | 728524 | SPDYE8P | speedy/RINGO cell cycle reg... | NR_003664.2 | 18.5% | (many diffs) | |
30 | human | 643862 | SPDYE10P | speedy/RINGO cell cycle reg... | NR_146079.1 | 18.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 843
- ORF length:
- 774
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggagtggtgg gacgaatctg aggagtcgtt ggaggaggag ccacggaagg 121 tgctcgcccc tgagcctgag gagatctggg tggcggagat gctgtgtggc ctcaagatga 181 agctgaagcg acggcgagtg tcgctcgtgc tccctgagca ccacgaggcc ttcaacaggc 241 tgcttgagga tcctgtcatt aaaagattct tggcctggga caaagatctg agggtgtcgg 301 acaagtatct cctggctatg gtcatagcgt atttcagccg ggccggcttc ccctcctggc 361 aataccaacg cattcatttc ttcctggctc tctacctggc caatgacatg gaggaggacg 421 acgaggactc caaacaaaac atcttccact tcctgtatag gaagaaccgc tctcgcatac 481 ccttgctccG TAAGCGTTGG TTCCAGTTAG GCCATTCCAT GAACCCGAGG GCCAGGAAGA 541 ACCGCTCTCG CATACCCTTG CTCCGTAAGC GTCGGTTCCA GTTATACCGT TCCACGAACC 601 CGAGGGCCAG GAAGAACCGC TCTCGCATAC CCTTGCTCCG TAAGCGTCGG TTCCAGTTAT 661 ACCGTTCCAT GAACTCGAGG GCCAGGAAGA ACCGCTCTCA GATAGTCCTG TTCCAGAAAC 721 GACGGTTCCA CTTCTTCTGT TCCATGAGCT GCAGGGCTTG GGTTTCCCCA GAGGAGTTGG 781 AGGAGATCCA GGCTTATGAC CCAGAGCACT GGGTGTGGGC GCGAGATCGC GCTCACCTTT 841 CCTTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 901 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 961 GGCTTTATAT ATCTTGTGGA AAGGACGATC AAGTGTCGAT CAACATATTA AGACGCGTTA 1021 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt