Construct: ORF TRCN0000492123
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021716.2_s317c1
- DNA Barcode:
- CGGATCTTCCTACATAGGCCATCA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- MET (4233)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000492123
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4233 | MET | MET proto-oncogene, recepto... | NM_001324402.2 | 43.6% | .2% | 1_1624del |
| 2 | human | 4233 | MET | MET proto-oncogene, recepto... | XM_006715990.2 | 43.6% | .2% | 1_1624del |
| 3 | human | 4233 | MET | MET proto-oncogene, recepto... | NM_000245.4 | 30.1% | .1% | 1_2914del |
| 4 | human | 4233 | MET | MET proto-oncogene, recepto... | NM_001127500.3 | 29.7% | .1% | 1_2968del |
| 5 | human | 4233 | MET | MET proto-oncogene, recepto... | XM_011516223.1 | 29.7% | .1% | 1_2971del |
| 6 | human | 4233 | MET | MET proto-oncogene, recepto... | XR_001744772.1 | 19.1% | 1_3045del;4302_6566del | |
| 7 | mouse | 17295 | Met | met proto-oncogene | XM_006505002.3 | 26.6% | .1% | (many diffs) |
| 8 | mouse | 17295 | Met | met proto-oncogene | NM_008591.2 | 26.4% | .1% | (many diffs) |
| 9 | mouse | 17295 | Met | met proto-oncogene | XM_011241042.2 | 26.4% | .1% | (many diffs) |
| 10 | mouse | 17295 | Met | met proto-oncogene | XM_011241043.2 | 26.4% | .1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 61
- ORF end:
- 97
- ORF length:
- 36
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaatacg 61 atgcaagagt acacactcct catttggata ggcttgtaag tgcccgaagt gtaagcccaa 121 ctacagaaat ggtttcaaat gaatctgtag actaccgagc tacttttcca gaagatcagt 181 ttcctaattc atctcagaac ggttcatgcc gacaagtgca gtatcctctg acagacatgt 241 cccccatcct aactagtggg gactctgata tatccagtcc attactgcaa aatactgtcc 301 acattgacct cagtgctcta aatccagagc tggtccaggc agtgcagcat gtagtgattg 361 ggcccagtag cctgattgtg catttcaatg aagtcatagg aagagggcat tttggttgtg 421 tatatcatgg gactttgttg gacaatgatg gcaagaaaat tcactgtgct gtgaaatcct 481 tgaacagaat cactgacata ggagaagttt cccaatttct gaccgaggga atcatcatga 541 aagattttag tcatcccaat gtcctctcgc tcctgggaat ctgcctgcga agtgaagggt 601 ctccgctggt ggtcctacca tacatgaaac atggagatct tcgaaatttc attcgaaatg 661 agactcataa tccaactgta aaagatctta ttggctttgg tcttcaagta gccaaaggca 721 tgaaatatct tgcaagcaaa aagtttgtcc acagagactt ggctgcaaga aactgtatgc 781 tggatgaaaa attcacagtc aaggttgctg attttggtct tgccagagac atgtatgata 841 aagaatacta tagtgtacac aacaaaacag gtgcaaagct gccagtgaag tggatggctt 901 tggaaagtct gcaaactcaa aagtttacca ccaagtcaga tgtgtggtcc tttggcgtgc 961 tcctctggga gctGATGACA AGAGGAGCCC CACCTTATCC TGACGTAAAC ACCTTTGATA 1021 TAACTGTTTA CTTGTTGCAA GGGAGAAGAC TCCTACAACC CGAATACTGC CCAGACCCCT 1081 TATATGAAGT AATGCTAAAA TGCTGGCACC CTAAAGCCGA AATGCGCCCA TCCTTTTCTG 1141 AACTGGTGTC CCGGATATCA GCGATCTTCT CTACTTTCAT TGGGGAGCAC TATGTCCATG 1201 TGAACGCTAC TTATGTGAAC GTAAAATGTG TCGCTCCGTA TCCTTCTCTG TTGTCATCAG 1261 AAGATAACGC TGATGATGAG GTGGACACAC GACCAGCCTC CTTCTGGGAG ACATCATAGG 1321 ACCCAGCTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1381 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1441 TTTATATATC TTGTGGAAAG GACGACGGAT CTTCCTACAT AGGCCATCAA CGCGTTAAGT 1501 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt