Transcript: Human XM_006715990.2

PREDICTED: Homo sapiens MET proto-oncogene, receptor tyrosine kinase (MET), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MET (4233)
Length:
5376
CDS:
232..3114

Additional Resources:

NCBI RefSeq record:
XM_006715990.2
NBCI Gene record:
MET (4233)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715990.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121090 GCATGTCAACATCGCTCTAAT pLKO.1 1306 CDS 100% 13.200 18.480 N MET n/a
2 TRCN0000040045 CGCTACTTATGTGAACGTAAA pLKO.1 3000 CDS 100% 10.800 15.120 N MET n/a
3 TRCN0000121087 GCACTATTATAGGACTTGTAT pLKO.1 3216 3UTR 100% 5.625 7.875 N MET n/a
4 TRCN0000009851 CATGTGAACGCTACTTATGTG pLKO.1 2992 CDS 100% 4.950 6.930 N MET n/a
5 TRCN0000121088 CCCTTATATGAAGTAATGCTA pLKO.1 2872 CDS 100% 3.000 4.200 N MET n/a
6 TRCN0000040046 CGAGCTAAATATAGAGTGGAA pLKO.1 1656 CDS 100% 2.640 3.696 N MET n/a
7 TRCN0000121232 CCTGTCATATTGGAGTCCAAA pLKO.1 3346 3UTR 100% 4.950 3.960 N MET n/a
8 TRCN0000196824 GAAGTCCTCTTAACATCTATA pLKO.1 247 CDS 100% 13.200 9.240 N MET n/a
9 TRCN0000040044 GCACGATGAATACATTGAAAT pLKO.1 791 CDS 100% 13.200 9.240 N MET n/a
10 TRCN0000196443 GTGTGTTGTATGGTCAATAAC pLKO.1 3553 3UTR 100% 13.200 9.240 N MET n/a
11 TRCN0000196866 GACTTATTCATGGGTCAATTC pLKO.1 223 5UTR 100% 10.800 7.560 N MET n/a
12 TRCN0000196414 GATAAGGAAATGTACTGATTG pLKO.1 4751 3UTR 100% 10.800 7.560 N MET n/a
13 TRCN0000196685 GCTGTGAGAATATACACTTAC pLKO.1 1583 CDS 100% 10.800 7.560 N MET n/a
14 TRCN0000121091 CCTGACGTAAACACCTTTGAT pLKO.1 2794 CDS 100% 5.625 3.938 N MET n/a
15 TRCN0000121251 CTCATTTGGATAGGCTTGTAA pLKO.1 1874 CDS 100% 5.625 3.938 N MET n/a
16 TRCN0000121089 AGACTCATAATCCAACTGTAA pLKO.1 2456 CDS 100% 4.950 3.465 N MET n/a
17 TRCN0000000395 CAGAAGTGATTGTGGAGCATA pLKO.1 404 CDS 100% 4.950 3.465 N MET n/a
18 TRCN0000121247 CCACACTTTGTCCAATGGTTT pLKO.1 3141 3UTR 100% 4.950 3.465 N MET n/a
19 TRCN0000199327 CCCGGATATCAGCGATCTTCT pLKO.1 2945 CDS 100% 4.950 3.465 N MET n/a
20 TRCN0000121250 CCGTGAAGATCCCATTGTCTA pLKO.1 1155 CDS 100% 4.950 3.465 N MET n/a
21 TRCN0000000396 CTGTTATTACTACTTGGGTTT pLKO.1 1774 CDS 100% 4.050 2.835 N MET n/a
22 TRCN0000040043 ATCAGAACCAGAGGCTTGGTC pLKO.1 3284 3UTR 100% 2.640 1.848 N MET n/a
23 TRCN0000010379 CATCAGAACCAGAGGCTTGGT pLKO.1 3283 3UTR 100% 2.640 1.848 N MET n/a
24 TRCN0000121235 GCCACGACAAATGTGTGCGAT pLKO.1 563 CDS 100% 2.640 1.848 N MET n/a
25 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 3863 3UTR 100% 10.800 5.400 Y MRPS16 n/a
26 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 3863 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715990.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14696 pDONR223 0% 69% 69% None 0_1ins1290 n/a
2 ccsbBroad304_14696 pLX_304 15.1% 69% 69% V5 0_1ins1290 n/a
3 TRCN0000471392 ACGGTCGACCTTTCGGTGCTTCCT pLX_317 8.8% 69% 69% V5 0_1ins1290 n/a
4 TRCN0000492212 TGCCAACATGACGCCTACAAGGAA pLX_317 10.6% 69% 69% V5 (not translated due to prior stop codon) 0_1ins1290;831T>C;834A>G n/a
5 TRCN0000489303 ACTAGCTCCGCGCACTTAACCCAA pLX_317 8.9% 69% 69% V5 (not translated due to prior stop codon) 0_1ins1290;831T>C;834A>G n/a
6 TRCN0000488821 CATCAAGAAACTATTACTCCGATA pLX_317 7.8% 68.9% 68.9% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000488471 GAGTTATTTCACGGACACGACAAC pLX_317 6.8% 68.9% 68.9% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000492123 CGGATCTTCCTACATAGGCCATCA pLX_317 28% 43.6% .2% V5 (not translated due to prior stop codon) 1_1624del n/a
Download CSV