Transcript: Mouse XM_011241043.2

PREDICTED: Mus musculus met proto-oncogene (Met), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Met (17295)
Length:
6439
CDS:
143..4282

Additional Resources:

NCBI RefSeq record:
XM_011241043.2
NBCI Gene record:
Met (17295)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011241043.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226124 GCATGGAGATCTGCGAAATTT pLKO_005 3619 CDS 100% 15.000 21.000 N Met n/a
2 TRCN0000226121 TCCTACACGGCCATCATATTT pLKO_005 309 CDS 100% 15.000 21.000 N Met n/a
3 TRCN0000218052 ATAAGTAACTTGCGGTGATAA pLKO_005 5265 3UTR 100% 13.200 18.480 N Met n/a
4 TRCN0000023530 GCACGACAAATACGTTGAAAT pLKO.1 1989 CDS 100% 13.200 18.480 N Met n/a
5 TRCN0000196414 GATAAGGAAATGTACTGATTG pLKO.1 5817 3UTR 100% 10.800 15.120 N MET n/a
6 TRCN0000023529 CGGGATTCTTTCCAAACACTT pLKO.1 2611 CDS 100% 4.950 6.930 N Met n/a
7 TRCN0000040046 CGAGCTAAATATAGAGTGGAA pLKO.1 2854 CDS 100% 2.640 3.696 N MET n/a
8 TRCN0000226122 TTGACAGACCAGTCCTATATT pLKO_005 824 CDS 100% 15.000 10.500 N Met n/a
9 TRCN0000226123 TAAGCGAGAGCACGACAAATA pLKO_005 1980 CDS 100% 13.200 9.240 N Met n/a
10 TRCN0000023531 CCCGACGTGAACACATTTGAT pLKO.1 3989 CDS 100% 5.625 3.938 N Met n/a
11 TRCN0000121251 CTCATTTGGATAGGCTTGTAA pLKO.1 3069 CDS 100% 5.625 3.938 N MET n/a
12 TRCN0000023532 CCAGTCCTATATTGATGTCTT pLKO.1 832 CDS 100% 4.950 3.465 N Met n/a
13 TRCN0000121089 AGACTCATAATCCAACTGTAA pLKO.1 3651 CDS 100% 4.950 3.465 N MET n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011241043.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14696 pDONR223 0% 85.7% 88.9% None (many diffs) n/a
2 ccsbBroad304_14696 pLX_304 15.1% 85.7% 88.9% V5 (many diffs) n/a
3 TRCN0000471392 ACGGTCGACCTTTCGGTGCTTCCT pLX_317 8.8% 85.7% 88.9% V5 (many diffs) n/a
4 TRCN0000492212 TGCCAACATGACGCCTACAAGGAA pLX_317 10.6% 85.7% 88.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489303 ACTAGCTCCGCGCACTTAACCCAA pLX_317 8.9% 85.7% 88.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000488821 CATCAAGAAACTATTACTCCGATA pLX_317 7.8% 85.7% 88.8% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000488471 GAGTTATTTCACGGACACGACAAC pLX_317 6.8% 85.7% 88.8% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000492123 CGGATCTTCCTACATAGGCCATCA pLX_317 28% 26.4% .1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV