Transcript: Human NM_000024.5

Homo sapiens adrenoceptor beta 2 (ADRB2), mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
ADRB2 (154)
Length:
2058
CDS:
240..1481

Additional Resources:

NCBI RefSeq record:
NM_000024.5
NBCI Gene record:
ADRB2 (154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000024.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356690 GGACCTGAGTCTGCTATATTT pLKO_005 1741 3UTR 100% 15.000 21.000 N ADRB2 n/a
2 TRCN0000356691 AGGTACTGTGCCTAGCGATAA pLKO_005 1412 CDS 100% 10.800 15.120 N ADRB2 n/a
3 TRCN0000008085 CCTCAAGACGTTAGGCATCAT pLKO.1 1052 CDS 100% 4.950 6.930 N ADRB2 n/a
4 TRCN0000008084 CCTCCTAAATTGGATAGGCTA pLKO.1 1166 CDS 100% 2.640 3.696 N ADRB2 n/a
5 TRCN0000356689 GAACACTAAACAGACTATTTA pLKO_005 1520 3UTR 100% 15.000 10.500 N ADRB2 n/a
6 TRCN0000378218 TCGCAGTGGATCGCTACTTTG pLKO_005 619 CDS 100% 10.800 7.560 N ADRB2 n/a
7 TRCN0000008083 CCTCTTTGCATGGAATTTGTA pLKO.1 1690 3UTR 100% 5.625 3.938 N ADRB2 n/a
8 TRCN0000008086 GCCATCAACTGCTATGCCAAT pLKO.1 780 CDS 100% 4.050 2.835 N ADRB2 n/a
9 TRCN0000011229 CCCAGATTTCAGGATTGCCTT pLKO.1 1226 CDS 100% 2.640 1.848 N ADRB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000024.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491269 AAATCCCGCTTGTTCCGGCGGATA pLX_317 24.9% 99.9% 99.7% V5 (not translated due to prior stop codon) 647T>C n/a
2 TRCN0000488071 TACATCTGCGGGACACGCTTTAGC pLX_317 24.8% 99.9% 99.7% V5 (not translated due to prior stop codon) 647T>C n/a
3 TRCN0000487831 CGTCCATAACCCTTAACCCGCTTT pLX_317 21.1% 99.8% 99.5% V5 647T>C;1239_1240insG n/a
4 ccsbBroadEn_05786 pDONR223 100% 99.8% 99.5% None 46A>G;79C>G n/a
5 ccsbBroad304_05786 pLX_304 0% 99.8% 99.5% V5 46A>G;79C>G n/a
6 TRCN0000488338 AACCACCCTAACTTCCAACATAGA pLX_317 24.6% 99.6% 99.5% V5 (many diffs) n/a
7 TRCN0000488268 CTACATTCCGGTATCAGCTAAGTC pLX_317 24.8% 99.6% 99.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV