Transcript: Human NM_000439.5

Homo sapiens proprotein convertase subtilisin/kexin type 1 (PCSK1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
PCSK1 (5122)
Length:
5136
CDS:
207..2468

Additional Resources:

NCBI RefSeq record:
NM_000439.5
NBCI Gene record:
PCSK1 (5122)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000439.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435584 AGTGGAATCACACGGACATTT pLKO_005 718 CDS 100% 13.200 18.480 N PCSK1 n/a
2 TRCN0000414712 CTCTTACAGCAGCGGAGATTA pLKO_005 1265 CDS 100% 13.200 10.560 N PCSK1 n/a
3 TRCN0000414168 TACGGGCAAAGGAGTTGTTAT pLKO_005 674 CDS 100% 13.200 9.240 N PCSK1 n/a
4 TRCN0000416241 GATAATGACCATGATCCATTT pLKO_005 777 CDS 100% 10.800 7.560 N PCSK1 n/a
5 TRCN0000051496 GCACTAAATCTCTTCAATGAT pLKO.1 555 CDS 100% 5.625 3.938 N PCSK1 n/a
6 TRCN0000051497 CCCTATAGGTACTTGGACTTT pLKO.1 1892 CDS 100% 4.950 3.465 N PCSK1 n/a
7 TRCN0000051495 GCCCTGAAAGCTAATGGAGAA pLKO.1 1638 CDS 100% 4.050 2.835 N PCSK1 n/a
8 TRCN0000051493 CCAACTATGATCCAGAGGCTA pLKO.1 742 CDS 100% 2.640 1.848 N PCSK1 n/a
9 TRCN0000051494 GCTCTGGTGGACATTCTGAAT pLKO.1 2436 CDS 100% 4.950 2.475 Y PCSK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000439.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06696 pDONR223 100% 99.9% 99.7% None 1993C>G;2069G>C n/a
2 ccsbBroad304_06696 pLX_304 0% 99.9% 99.7% V5 1993C>G;2069G>C n/a
3 TRCN0000469428 AAATCATTGCACGAGACTATGGAA pLX_317 19.5% 99.9% 99.7% V5 1993C>G;2069G>C n/a
Download CSV