Transcript: Human NM_000693.4

Homo sapiens aldehyde dehydrogenase 1 family member A3 (ALDH1A3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ALDH1A3 (220)
Length:
3469
CDS:
78..1616

Additional Resources:

NCBI RefSeq record:
NM_000693.4
NBCI Gene record:
ALDH1A3 (220)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000693.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442859 GAGCGAATAGCACCGACTATG pLKO_005 1369 CDS 100% 10.800 15.120 N ALDH1A3 n/a
2 TRCN0000027144 GCTGTATTAGAACCCTCAGAT pLKO.1 484 CDS 100% 4.950 6.930 N ALDH1A3 n/a
3 TRCN0000027183 GCCGAATACACAGAAGTGAAA pLKO.1 1560 CDS 100% 4.950 3.960 N ALDH1A3 n/a
4 TRCN0000414303 AGATACTCAGGGCGTTGTTAA pLKO_005 1894 3UTR 100% 13.200 9.240 N ALDH1A3 n/a
5 TRCN0000423890 TGTCCAGCAGTTGCTTGAAAT pLKO_005 1934 3UTR 100% 13.200 9.240 N ALDH1A3 n/a
6 TRCN0000027160 GAGCAGGTCTACTCTGAGTTT pLKO.1 1047 CDS 100% 4.950 3.465 N ALDH1A3 n/a
7 TRCN0000027171 GCAACCAATACTGAAGTTCAA pLKO.1 1325 CDS 100% 4.950 3.465 N ALDH1A3 n/a
8 TRCN0000027212 CCACAGATGACAACGTCGTAT pLKO.1 547 CDS 100% 4.950 3.465 N ALDH1A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000693.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489297 GATCTGGAACCTAGAAGCTTCATA pLX_317 23.9% 99.8% 99.6% V5 (not translated due to frame shift) 1528delA;1536_1537insG n/a
2 TRCN0000489915 GCAGCTTCCAAACTCTGAACACTA pLX_317 29.2% 99.9% 100% V5 (not translated due to prior stop codon) 1326C>T n/a
3 TRCN0000481406 TTGATACCTCTGGACACCCCTTTT pLX_317 100% 10.7% 8.1% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000471259 TCTCAGAAGGAACAAGGCCCACCG pLX_317 100% 10.7% 8.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV