Transcript: Human NM_000770.3

Homo sapiens cytochrome P450 family 2 subfamily C member 8 (CYP2C8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
CYP2C8 (1558)
Length:
1924
CDS:
96..1568

Additional Resources:

NCBI RefSeq record:
NM_000770.3
NBCI Gene record:
CYP2C8 (1558)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235064 TGGCACTGTAGCTGATCTATT pLKO_005 959 CDS 100% 13.200 18.480 N CYP2C8 n/a
2 TRCN0000235062 GTTGCTCTTACACGAAGTTAC pLKO_005 804 CDS 100% 10.800 15.120 N CYP2C8 n/a
3 TRCN0000064072 GCAGTTACCAAAGGGATTGTT pLKO.1 1506 CDS 100% 5.625 7.875 N CYP2C8 n/a
4 TRCN0000064069 CCACTGATACTAAGTTCAGAA pLKO.1 1207 CDS 100% 4.950 6.930 N CYP2C8 n/a
5 TRCN0000235063 CCAAGCATCACTGGATGTTAA pLKO_005 848 CDS 100% 13.200 10.560 N CYP2C8 n/a
6 TRCN0000235065 CAAGGACATTCCCACTATTAT pLKO_005 1624 3UTR 100% 15.000 10.500 N CYP2C8 n/a
7 TRCN0000235061 CCTCACAACCTTGCGGAATTT pLKO_005 476 CDS 100% 13.200 9.240 N CYP2C8 n/a
8 TRCN0000064070 CCTCTTCCTATTATTGGAAAT pLKO.1 198 CDS 100% 10.800 7.560 N CYP2C8 n/a
9 TRCN0000064071 CGAAGTTACATTAGGGAGAAA pLKO.1 816 CDS 100% 4.950 3.465 N CYP2C8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000770.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00408 pDONR223 100% 84.7% 77.9% None (many diffs) n/a
2 ccsbBroad304_00408 pLX_304 0% 84.7% 77.9% V5 (many diffs) n/a
3 TRCN0000469884 CCCTTCGTGCCAACCAGCCCTGGA pLX_317 28.5% 84.7% 77.9% V5 (many diffs) n/a
4 ccsbBroadEn_00409 pDONR223 100% 84.5% 77.1% None (many diffs) n/a
5 ccsbBroad304_00409 pLX_304 0% 84.5% 77.1% V5 (many diffs) n/a
6 TRCN0000480849 TTGTGTCTTGCGGCTCGGGATGGG pLX_317 26.8% 84.5% 77.1% V5 (many diffs) n/a
7 ccsbBroadEn_10763 pDONR223 100% 28.9% 25.5% None (many diffs) n/a
8 ccsbBroad304_10763 pLX_304 0% 28.9% 25.5% V5 (many diffs) n/a
9 TRCN0000475303 TGCAACCTTACTCCTTTTATACCA pLX_317 67.3% 28.9% 25.5% V5 (many diffs) n/a
Download CSV