Transcript: Human NM_000811.3

Homo sapiens gamma-aminobutyric acid type A receptor alpha6 subunit (GABRA6), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
GABRA6 (2559)
Length:
2450
CDS:
270..1631

Additional Resources:

NCBI RefSeq record:
NM_000811.3
NBCI Gene record:
GABRA6 (2559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000811.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430221 GCTACTTCATGATACAGATAT pLKO_005 991 CDS 100% 13.200 18.480 N GABRA6 n/a
2 TRCN0000061317 GCGCCCATCTTACAATCAACA pLKO.1 1449 CDS 100% 4.950 6.930 N GABRA6 n/a
3 TRCN0000434760 GGAGGCCTTTATGCTAGTAAA pLKO_005 2091 3UTR 100% 13.200 10.560 N GABRA6 n/a
4 TRCN0000061316 CTAGGGAAACTCGAAGTTGAA pLKO.1 321 CDS 100% 4.950 3.960 N GABRA6 n/a
5 TRCN0000061315 CTCCTAATAAACTCTTCAGAA pLKO.1 661 CDS 100% 4.950 3.465 N GABRA6 n/a
6 TRCN0000419453 AGTATCTAGTGAGACAATTAA pLKO_005 911 CDS 100% 15.000 9.000 N GABRA6 n/a
7 TRCN0000061313 CCAGGTGTCTTTCTGGATTAA pLKO.1 1043 CDS 100% 13.200 7.920 N GABRA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000811.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06242 pDONR223 100% 99.8% 100% None 951G>T;1344C>G n/a
2 ccsbBroad304_06242 pLX_304 0% 99.8% 100% V5 951G>T;1344C>G n/a
3 TRCN0000491845 TAGATACCCGGTCTCTAGAACCTC pLX_317 9.9% 99.8% 100% V5 951G>T;1344C>G n/a
Download CSV