Transcript: Human NM_000969.5

Homo sapiens ribosomal protein L5 (RPL5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
RPL5 (6125)
Length:
1028
CDS:
76..969

Additional Resources:

NCBI RefSeq record:
NM_000969.5
NBCI Gene record:
RPL5 (6125)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000969.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074993 GATGATAGTTCGTGTGACAAA pLKO.1 225 CDS 100% 4.950 6.930 N RPL5 n/a
2 TRCN0000291974 GATGATAGTTCGTGTGACAAA pLKO_005 225 CDS 100% 4.950 6.930 N RPL5 n/a
3 TRCN0000074995 CGCTACTTAATGGAAGAAGAT pLKO.1 700 CDS 100% 4.950 3.960 N RPL5 n/a
4 TRCN0000291975 CGCTACTTAATGGAAGAAGAT pLKO_005 700 CDS 100% 4.950 3.960 N RPL5 n/a
5 TRCN0000074996 GCCTACTTTAAGAGATACCAA pLKO.1 106 CDS 100% 3.000 2.400 N RPL5 n/a
6 TRCN0000292025 GCCTACTTTAAGAGATACCAA pLKO_005 106 CDS 100% 3.000 2.400 N RPL5 n/a
7 TRCN0000074997 CCCTCACAGTACCAAACGATT pLKO.1 594 CDS 100% 4.950 3.465 N RPL5 n/a
8 TRCN0000291973 CCCTCACAGTACCAAACGATT pLKO_005 594 CDS 100% 4.950 3.465 N RPL5 n/a
9 TRCN0000074994 GTTCGTGTGACAAACAGAGAT pLKO.1 232 CDS 100% 4.950 3.465 N RPL5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000969.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11104 pDONR223 100% 34% 32.9% None 292_361del;374_891del n/a
2 ccsbBroad304_11104 pLX_304 0% 34% 32.9% V5 292_361del;374_891del n/a
3 TRCN0000473011 ATGTTATTTAATGTTTCATATAGG pLX_317 100% 34% 32.9% V5 292_361del;374_891del n/a
Download CSV