Transcript: Human NM_000980.4

Homo sapiens ribosomal protein L18a (RPL18A), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
RPL18A (6142)
Length:
634
CDS:
48..578

Additional Resources:

NCBI RefSeq record:
NM_000980.4
NBCI Gene record:
RPL18A (6142)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000980.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000297027 AGTCCCGCTTCTGGTACTTTG pLKO_005 169 CDS 100% 10.800 15.120 N Gm15427 n/a
2 TRCN0000438128 AGTCCCGCTTCTGGTACTTTG pLKO_005 169 CDS 100% 10.800 15.120 N RPL18A n/a
3 TRCN0000117612 CCACAACATGTACCGGGAATA pLKO.1 317 CDS 100% 10.800 15.120 N RPL18A n/a
4 TRCN0000420593 CTAATCATGTCGTCGCCAAGT pLKO_005 151 CDS 100% 4.050 5.670 N RPL18A n/a
5 TRCN0000117613 CATGCGAATCTTTGCGCCTAA pLKO.1 134 CDS 100% 4.050 3.240 N RPL18A n/a
6 TRCN0000445003 TCTACTGTGGGCAGGTGTTTG pLKO_005 232 CDS 100% 10.800 7.560 N RPL18A n/a
7 TRCN0000415628 CCACGACTCCAAGATCAAGTT pLKO_005 482 CDS 100% 4.950 3.465 N RPL18A n/a
8 TRCN0000117614 CCACTCCATTCAGATCATGAA pLKO.1 410 CDS 100% 4.950 3.465 N RPL18A n/a
9 TRCN0000117615 TGGTACTTTGTATCTCAGTTA pLKO.1 180 CDS 100% 4.950 3.465 N RPL18A n/a
10 TRCN0000117616 GCGGGTGAAGAACTTCGGGAT pLKO.1 266 CDS 100% 0.720 0.504 N RPL18A n/a
11 TRCN0000204689 GATCATGAAGGTGGAGGAGAT pLKO.1 422 CDS 100% 4.050 2.430 N RPL18AP4 n/a
12 TRCN0000272119 TCCACGACTCCAAGATCAAAT pLKO_005 481 CDS 100% 13.200 9.240 N Gm15427 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000980.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06883 pDONR223 100% 99.8% 100% None 306C>A n/a
2 ccsbBroad304_06883 pLX_304 0% 99.8% 100% V5 306C>A n/a
3 TRCN0000466395 ACACTTCCGAAAATTGCCGAATAG pLX_317 58.7% 99.8% 100% V5 306C>A n/a
Download CSV