Transcript: Human NM_001001290.1

Homo sapiens solute carrier family 2 member 9 (SLC2A9), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
SLC2A9 (56606)
Length:
1885
CDS:
160..1695

Additional Resources:

NCBI RefSeq record:
NM_001001290.1
NBCI Gene record:
SLC2A9 (56606)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412963 AGGTGCTATCTACCTGTATTT pLKO_005 1542 CDS 100% 13.200 18.480 N SLC2A9 n/a
2 TRCN0000043683 ACGTTGGACAATTATGTCAAA pLKO.1 1711 3UTR 100% 4.950 6.930 N SLC2A9 n/a
3 TRCN0000413432 ACACTTTGCTGGCCAATAATG pLKO_005 488 CDS 100% 13.200 9.240 N SLC2A9 n/a
4 TRCN0000043687 CTGTCACTGATGGTAAGATAA pLKO.1 1661 CDS 100% 13.200 9.240 N SLC2A9 n/a
5 TRCN0000043684 CGCTTCATCATGGGCATAGAT pLKO.1 583 CDS 100% 5.625 3.938 N SLC2A9 n/a
6 TRCN0000043685 CCATACCTGTTTGGAGTGATT pLKO.1 766 CDS 100% 4.950 3.465 N SLC2A9 n/a
7 TRCN0000043686 CCTCAATGCAATTTGGTTCTA pLKO.1 1065 CDS 100% 4.950 2.970 N SLC2A9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001290.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08643 pDONR223 100% 99.6% 99.6% None (many diffs) n/a
2 ccsbBroad304_08643 pLX_304 0% 99.6% 99.6% V5 (many diffs) n/a
3 ccsbBroadEn_08644 pDONR223 100% 91.4% 90.9% None (many diffs) n/a
4 ccsbBroad304_08644 pLX_304 0% 91.4% 90.9% V5 (many diffs) n/a
5 TRCN0000475907 GGATACGCATCCGCTTATTAGATA pLX_317 23.7% 91.4% 90.9% V5 (many diffs) n/a
Download CSV