Transcript: Human NM_001001872.4

Homo sapiens armadillo like helical domain containing 4 (ARMH4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
ARMH4 (145407)
Length:
6495
CDS:
196..2520

Additional Resources:

NCBI RefSeq record:
NM_001001872.4
NBCI Gene record:
ARMH4 (145407)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001872.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121752 CCATCTATTACTCGTGTTAAT pLKO.1 1966 CDS 100% 13.200 18.480 N ARMH4 n/a
2 TRCN0000142720 CGAAGGAGAAATGGCTTCAAA pLKO.1 2416 CDS 100% 5.625 3.938 N ARMH4 n/a
3 TRCN0000122652 GAGTGGGAACAGCAGAATCAA pLKO.1 2257 CDS 100% 5.625 3.938 N ARMH4 n/a
4 TRCN0000144724 GAAGAACTGTTGTTCCATCTA pLKO.1 1952 CDS 100% 4.950 3.465 N ARMH4 n/a
5 TRCN0000143231 GAATCTGAAGAGGGACAAGAA pLKO.1 2017 CDS 100% 4.950 3.465 N ARMH4 n/a
6 TRCN0000140587 GCATCCTCTGAGAGAAGAACT pLKO.1 1939 CDS 100% 4.950 3.465 N ARMH4 n/a
7 TRCN0000139540 CGTGTTAATACAGCTGCCTCA pLKO.1 1978 CDS 100% 2.160 1.512 N ARMH4 n/a
8 TRCN0000140047 CCGAAGGAGAAATGGCTTCAA pLKO.1 2415 CDS 100% 4.950 2.970 N ARMH4 n/a
9 TRCN0000144995 GAAGAGGATGAAGAAGATGAA pLKO.1 2047 CDS 100% 4.950 2.970 N ARMH4 n/a
10 TRCN0000143538 GATGAGGATGAAGAGGATGAA pLKO.1 2038 CDS 100% 4.950 2.970 N ARMH4 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6383 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000018931 GAAGAAGATGAAGATGAAGAA pLKO.1 2056 CDS 100% 4.950 2.475 Y HMGB1 n/a
13 TRCN0000143232 GAAGAGGAAGATGAGGAAGAA pLKO.1 2074 CDS 100% 4.950 2.475 Y ARMH4 n/a
14 TRCN0000145323 GAAGATGAAGAAGAGGAAGAT pLKO.1 2065 CDS 100% 4.950 2.475 Y ARMH4 n/a
15 TRCN0000143206 GATGAGGAAGAAGATGAGGAA pLKO.1 2083 CDS 100% 2.640 1.320 Y ARMH4 n/a
16 TRCN0000174457 CAACTTGAATCTGAAGAGGTA pLKO.1 2011 CDS 100% 2.640 1.584 N 3632451O06Rik n/a
17 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6384 3UTR 100% 13.200 6.600 Y LIAS n/a
18 TRCN0000093082 GAAGATGAAGATGAAGAAGAA pLKO.1 2059 CDS 100% 4.950 2.475 Y Gm5518 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001872.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09619 pDONR223 100% 99.9% 99.7% None 287C>T;1837C>G n/a
2 ccsbBroad304_09619 pLX_304 0% 99.9% 99.7% V5 287C>T;1837C>G n/a
3 TRCN0000480285 TGTAGCTGACGCTCAGAAAATGGG pLX_317 16.3% 99.9% 99.7% V5 287C>T;1837C>G n/a
Download CSV