Transcript: Human NM_001001890.3

Homo sapiens RUNX family transcription factor 1 (RUNX1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
RUNX1 (861)
Length:
7283
CDS:
1588..2949

Additional Resources:

NCBI RefSeq record:
NM_001001890.3
NBCI Gene record:
RUNX1 (861)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001890.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000338428 CTACGATCAGTCCTACCAATA pLKO_005 2346 CDS 100% 10.800 15.120 N RUNX1 n/a
2 TRCN0000013658 GCCTTGAAATACCTGTTTCTT pLKO.1 6152 3UTR 100% 5.625 7.875 N RUNX1 n/a
3 TRCN0000013659 CCTACGATCAGTCCTACCAAT pLKO.1 2345 CDS 100% 4.950 6.930 N RUNX1 n/a
4 TRCN0000013661 CGGTCGAAGTGGAAGAGGGAA pLKO.1 1998 CDS 100% 0.880 1.232 N RUNX1 n/a
5 TRCN0000338490 GAACCACTCCACTGCCTTTAA pLKO_005 2265 CDS 100% 13.200 9.240 N RUNX1 n/a
6 TRCN0000338492 TCGCCCTGTTTGGCATCTAAT pLKO_005 3407 3UTR 100% 13.200 9.240 N RUNX1 n/a
7 TRCN0000013660 CCTCGAAGACATCGGCAGAAA pLKO.1 2113 CDS 100% 4.950 3.465 N RUNX1 n/a
8 TRCN0000338489 CCTCGAAGACATCGGCAGAAA pLKO_005 2113 CDS 100% 4.950 3.465 N RUNX1 n/a
9 TRCN0000338427 GAACCAGGTTGCAAGATTTAA pLKO_005 1962 CDS 100% 15.000 9.000 N RUNX1 n/a
10 TRCN0000358352 CTGTGATGGCTGGCAATGATG pLKO_005 1898 CDS 100% 4.950 2.970 N RUNX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001890.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00229 pDONR223 100% 93.8% 93.5% None (many diffs) n/a
2 TRCN0000476234 ATTTCTAGGCCACCTCGTTGAGCA pLX_317 15.9% 93.8% 93.5% V5 (many diffs) n/a
Download CSV