Transcript: Human NM_001001924.2

Homo sapiens microtubule associated scaffold protein 1 (MTUS1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Homo sapiens (human)
Gene:
MTUS1 (57509)
Length:
6435
CDS:
475..4287

Additional Resources:

NCBI RefSeq record:
NM_001001924.2
NBCI Gene record:
MTUS1 (57509)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001924.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063673 GCCTAACACTATCCTGTAATT pLKO.1 5066 3UTR 100% 13.200 18.480 N MTUS1 n/a
2 TRCN0000288675 GCCTAACACTATCCTGTAATT pLKO_005 5066 3UTR 100% 13.200 18.480 N MTUS1 n/a
3 TRCN0000063674 CGGGACACTTACATTGAAGAA pLKO.1 3529 CDS 100% 4.950 3.960 N MTUS1 n/a
4 TRCN0000063677 CCAGTGATAAAGATGGAAATA pLKO.1 530 CDS 100% 13.200 9.240 N MTUS1 n/a
5 TRCN0000288613 CCAGTGATAAAGATGGAAATA pLKO_005 530 CDS 100% 13.200 9.240 N MTUS1 n/a
6 TRCN0000063676 GCCTGTGGTAATACCAAGTTT pLKO.1 3253 CDS 100% 5.625 3.938 N MTUS1 n/a
7 TRCN0000288614 GCCTGTGGTAATACCAAGTTT pLKO_005 3253 CDS 100% 5.625 3.938 N MTUS1 n/a
8 TRCN0000042455 GCTGTGTTAGAGATCAAGAAT pLKO.1 3907 CDS 100% 5.625 3.938 N Mtus1 n/a
9 TRCN0000063675 CCAAACTTCAAGAATGTCAAA pLKO.1 1987 CDS 100% 4.950 3.465 N MTUS1 n/a
10 TRCN0000288677 CCAAACTTCAAGAATGTCAAA pLKO_005 1987 CDS 100% 4.950 3.465 N MTUS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001924.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08738 pDONR223 100% 33.1% 31.5% None (many diffs) n/a
2 ccsbBroad304_08738 pLX_304 0% 33.1% 31.5% V5 (many diffs) n/a
3 TRCN0000476738 AAGCCACTAAGTTGCCGGTGGCTA pLX_317 26.8% 33.1% 31.5% V5 (many diffs) n/a
4 ccsbBroadEn_12354 pDONR223 100% 18.8% 18.8% None 1_3090del;3188A>C n/a
5 ccsbBroad304_12354 pLX_304 0% 18.8% 18.8% V5 1_3090del;3188A>C n/a
6 TRCN0000480502 TCTGGCAGATAGACTCTTAATTTT pLX_317 57.9% 18.8% 18.8% V5 1_3090del;3188A>C n/a
Download CSV