Transcript: Mouse NM_001003671.1

Mus musculus protocadherin alpha subfamily C, 1 (Pcdhac1), mRNA.

Source:
NCBI, updated 2017-04-25
Taxon:
Mus musculus (mouse)
Gene:
Pcdhac1 (353236)
Length:
5296
CDS:
1..2895

Additional Resources:

NCBI RefSeq record:
NM_001003671.1
NBCI Gene record:
Pcdhac1 (353236)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001003671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094870 GCCCGGAACTTGTACTTGATA pLKO.1 2038 CDS 100% 5.625 7.875 N Pcdhac1 n/a
2 TRCN0000094871 CGGGAGTTACTGTAGGCAATA pLKO.1 95 CDS 100% 10.800 8.640 N Pcdhac1 n/a
3 TRCN0000094872 GCACAGTGATTGCTCTCCTTA pLKO.1 1067 CDS 100% 4.950 3.465 N Pcdhac1 n/a
4 TRCN0000094873 CCCAGATTGTTGCTCTCAGAA pLKO.1 2133 CDS 100% 4.950 2.970 N Pcdhac1 n/a
5 TRCN0000094087 CGGTGAGTTGCCAGACAAATT pLKO.1 2685 CDS 100% 13.200 6.600 Y Pcdha6 n/a
6 TRCN0000094979 GCATCCTGTCTTGATGATATT pLKO.1 3214 3UTR 100% 13.200 6.600 Y Pcdha9 n/a
7 TRCN0000094984 GCCAGCAGTTCAAGCGTTTAA pLKO.1 3583 3UTR 100% 13.200 6.600 Y Pcdha12 n/a
8 TRCN0000094754 GCTGCTACAGAAGTGCTTTAA pLKO.1 3912 3UTR 100% 13.200 6.600 Y Pcdha5 n/a
9 TRCN0000094349 CCTCACTTTATGCTGTTTGTT pLKO.1 3761 3UTR 100% 5.625 2.813 Y Pcdha4 n/a
10 TRCN0000094939 CGGAATATCAGCTTGTAGAAA pLKO.1 4746 3UTR 100% 5.625 2.813 Y Pcdhac2 n/a
11 TRCN0000094869 GCACAACTTAGATGTTTGATT pLKO.1 4815 3UTR 100% 5.625 2.813 Y Pcdhac1 n/a
12 TRCN0000094548 GCCTGCTAACAACCAAATTGA pLKO.1 2748 CDS 100% 5.625 2.813 Y Pcdha7 n/a
13 TRCN0000094089 CCGGAATATCAGCTTGTAGAA pLKO.1 4745 3UTR 100% 4.950 2.475 Y Pcdha1 n/a
14 TRCN0000094544 CGCTCCTTTCTCCTATGACAT pLKO.1 2969 3UTR 100% 4.950 2.475 Y Pcdha7 n/a
15 TRCN0000094699 GCCCTCAGAAATCTGCAGAAA pLKO.1 2992 3UTR 100% 4.950 2.475 Y Pcdha2 n/a
16 TRCN0000094086 GCTAACAACCAAATTGACAAA pLKO.1 2752 CDS 100% 4.950 2.475 Y Pcdha6 n/a
17 TRCN0000094179 GCTGGCTATAACATCACTGTA pLKO.1 3537 3UTR 100% 4.950 2.475 Y Pcdha10 n/a
18 TRCN0000094874 CCAAATGGAAACAAGCCACTT pLKO.1 2901 3UTR 100% 4.050 2.025 Y Pcdha8 n/a
19 TRCN0000094644 CCACCTTGTTTAGCTTTCCTT pLKO.1 4215 3UTR 100% 3.000 1.500 Y Pcdha11 n/a
20 TRCN0000094614 GCACTTTGATTACACAACCTT pLKO.1 4074 3UTR 100% 3.000 1.500 Y Pcdha3 n/a
21 TRCN0000094877 ACAAATTCATTATCCCAGGAT pLKO.1 2699 CDS 100% 2.640 1.320 Y Pcdha8 n/a
22 TRCN0000094183 CCCGGTGAGTTGCCAGACAAA pLKO.1 2683 CDS 100% 1.650 0.825 Y Pcdha10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003671.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.