Transcript: Mouse NM_001003918.2

Mus musculus ubiquitin specific peptidase 7 (Usp7), mRNA.

Source:
NCBI, updated 2017-05-06
Taxon:
Mus musculus (mouse)
Gene:
Usp7 (252870)
Length:
5427
CDS:
58..3369

Additional Resources:

NCBI RefSeq record:
NM_001003918.2
NBCI Gene record:
Usp7 (252870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001003918.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087151 GCAACTTATGAGGTTCATGTA pLKO.1 1272 CDS 100% 4.950 6.930 N Usp7 n/a
2 TRCN0000318259 GCAACTTATGAGGTTCATGTA pLKO_005 1272 CDS 100% 4.950 6.930 N Usp7 n/a
3 TRCN0000087150 CCTGCAATGTTAGATAATGAA pLKO.1 1963 CDS 100% 5.625 3.938 N Usp7 n/a
4 TRCN0000318333 CCTGCAATGTTAGATAATGAA pLKO_005 1963 CDS 100% 5.625 3.938 N Usp7 n/a
5 TRCN0000087149 CCCTGGATTTGTGGTCACATT pLKO.1 2478 CDS 100% 4.950 3.465 N Usp7 n/a
6 TRCN0000318335 CCCTGGATTTGTGGTCACATT pLKO_005 2478 CDS 100% 4.950 3.465 N Usp7 n/a
7 TRCN0000087152 GCCGAATTTAACAGAGAGAAT pLKO.1 2277 CDS 100% 4.950 3.465 N Usp7 n/a
8 TRCN0000318334 GCCGAATTTAACAGAGAGAAT pLKO_005 2277 CDS 100% 4.950 3.465 N Usp7 n/a
9 TRCN0000087148 GCGTAGCTTTATTTGAGTCTT pLKO.1 4327 3UTR 100% 4.950 3.465 N Usp7 n/a
10 TRCN0000349544 GCGTAGCTTTATTTGAGTCTT pLKO_005 4327 3UTR 100% 4.950 3.465 N Usp7 n/a
11 TRCN0000004059 TGTATCTATTGACTGCCCTTT pLKO.1 3526 3UTR 100% 4.050 2.835 N USP7 n/a
12 TRCN0000349627 TGTATCTATTGACTGCCCTTT pLKO_005 3526 3UTR 100% 4.050 2.835 N USP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003918.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488632 CAAAGCCTTACGGATTTATGACCC pLX_317 9.7% 92.5% 99% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488786 AGGTGGATCCGCTATATAACTTTG pLX_317 11.6% 92.4% 99% V5 (many diffs) n/a
Download CSV