Transcript: Human NM_001004127.3

Homo sapiens ALG11 alpha-1,2-mannosyltransferase (ALG11), transcript variant A, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ALG11 (440138)
Length:
6510
CDS:
22..1500

Additional Resources:

NCBI RefSeq record:
NM_001004127.3
NBCI Gene record:
ALG11 (440138)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004127.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159718 GCTATGTTCATTATCCTACTA pLKO.1 605 CDS 100% 4.950 6.930 N UTP14C n/a
2 TRCN0000147364 GATGTTAATGTCAACGGTCAA pLKO.1 331 CDS 100% 4.050 5.670 N ALG11 n/a
3 TRCN0000179299 GTTGTTTATACCGGCGATGTT pLKO.1 316 CDS 100% 4.950 3.960 N ALG11 n/a
4 TRCN0000163066 CCATTGCAGATCAGAGCCTTT pLKO.1 967 CDS 100% 4.050 3.240 N UTP14C n/a
5 TRCN0000093731 CCTTGTGATGTGCAGACATTT pLKO.1 862 CDS 100% 13.200 9.240 N Alg11 n/a
6 TRCN0000159823 GCTTCCTCTGTTTAAGTATAT pLKO.1 564 CDS 100% 13.200 9.240 N UTP14C n/a
7 TRCN0000158452 CAGCAAAGTAAAGCTCATCTA pLKO.1 708 CDS 100% 4.950 2.970 N UTP14C n/a
8 TRCN0000200741 GCCATATCATTAAGCCCATAA pLKO.1 3888 3UTR 100% 10.800 5.400 Y Utp14b n/a
9 TRCN0000147476 GCTTCCATTCTTGGTATACAT pLKO.1 1674 3UTR 100% 5.625 2.813 Y ALG11 n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4870 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4870 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000147394 GAAGCAATCATTTCCCTTGAT pLKO.1 1853 3UTR 100% 4.950 2.475 Y ALG11 n/a
13 TRCN0000161590 GCAGATTCTCTGATCAGGAAT pLKO.1 1436 CDS 100% 4.950 2.475 Y UTP14C n/a
14 TRCN0000159428 GCCTTTGCTAAATTGCTGAAT pLKO.1 982 CDS 100% 4.950 2.475 Y UTP14C n/a
15 TRCN0000161077 GCTGAAACTATCGCTCACATT pLKO.1 1357 CDS 100% 4.950 2.475 Y UTP14C n/a
16 TRCN0000179488 GATGGAAAGAATAGGCGGAAA pLKO.1 1871 3UTR 100% 4.050 2.025 Y ALG11 n/a
17 TRCN0000158999 GAATTTGAAGTGACATTCCTA pLKO.1 1453 CDS 100% 3.000 1.500 Y UTP14C n/a
18 TRCN0000160704 CGAAGGAGATATAACTGGCTT pLKO.1 1311 CDS 100% 2.640 1.320 Y UTP14C n/a
19 TRCN0000138963 CGTGAAGAAAGGAAAGGCCAA pLKO.1 2476 3UTR 100% 2.160 1.080 Y UTP14A n/a
20 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5035 3UTR 100% 10.800 5.400 Y SMIM11A n/a
21 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 4942 3UTR 100% 4.950 2.475 Y LOC339059 n/a
22 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4868 3UTR 100% 4.950 2.475 Y ERN2 n/a
23 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4868 3UTR 100% 4.950 2.475 Y P3H4 n/a
24 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4868 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004127.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10161 pDONR223 100% 99.9% 99.7% None 287C>T n/a
2 ccsbBroad304_10161 pLX_304 0% 99.9% 99.7% V5 287C>T n/a
3 TRCN0000476301 TTGAAACACCAATGATCCTCACAC pLX_317 24.2% 99.9% 99.7% V5 287C>T n/a
Download CSV