Transcript: Mouse NM_001005865.3

Mus musculus mitochondrial tumor suppressor 1 (Mtus1), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Mtus1 (102103)
Length:
4169
CDS:
339..1661

Additional Resources:

NCBI RefSeq record:
NM_001005865.3
NBCI Gene record:
Mtus1 (102103)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001005865.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042455 GCTGTGTTAGAGATCAAGAAT pLKO.1 1281 CDS 100% 5.625 3.938 N Mtus1 n/a
2 TRCN0000042453 GCCTGTATTAACCAAGTCATA pLKO.1 2174 3UTR 100% 4.950 3.465 N Mtus1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005865.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08738 pDONR223 100% 83.5% 86.5% None (many diffs) n/a
2 ccsbBroad304_08738 pLX_304 0% 83.5% 86.5% V5 (many diffs) n/a
3 TRCN0000476738 AAGCCACTAAGTTGCCGGTGGCTA pLX_317 26.8% 83.5% 86.5% V5 (many diffs) n/a
4 ccsbBroadEn_12354 pDONR223 100% 46.5% 50.2% None (many diffs) n/a
5 ccsbBroad304_12354 pLX_304 0% 46.5% 50.2% V5 (many diffs) n/a
6 TRCN0000480502 TCTGGCAGATAGACTCTTAATTTT pLX_317 57.9% 46.5% 50.2% V5 (many diffs) n/a
Download CSV