Transcript: Human NM_001006626.2

Homo sapiens cholinergic receptor muscarinic 2 (CHRM2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
CHRM2 (1129)
Length:
5832
CDS:
450..1850

Additional Resources:

NCBI RefSeq record:
NM_001006626.2
NBCI Gene record:
CHRM2 (1129)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001006626.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350592 TCCGGAGTGTTAAGCATATTT pLKO_005 2346 3UTR 100% 15.000 21.000 N CHRM2 n/a
2 TRCN0000315418 GCTCTTACAAGTCCTTATAAG pLKO_005 486 CDS 100% 13.200 10.560 N CHRM2 n/a
3 TRCN0000011256 CCTCAGTTTGGTGACCATTAT pLKO.1 545 CDS 100% 13.200 9.240 N CHRM2 n/a
4 TRCN0000350591 CCTCAGTTTGGTGACCATTAT pLKO_005 545 CDS 100% 13.200 9.240 N CHRM2 n/a
5 TRCN0000011254 CGGCTATTGCAGCCTTCTATT pLKO.1 1018 CDS 100% 13.200 9.240 N CHRM2 n/a
6 TRCN0000011257 CAGGTCAGAATGGAGATGAAA pLKO.1 1498 CDS 100% 5.625 3.938 N CHRM2 n/a
7 TRCN0000350537 CAGGTCAGAATGGAGATGAAA pLKO_005 1498 CDS 100% 5.625 3.938 N CHRM2 n/a
8 TRCN0000011258 CACCAGGACAATCTTGGCTAT pLKO.1 1604 CDS 100% 4.050 2.835 N CHRM2 n/a
9 TRCN0000350538 CACCAGGACAATCTTGGCTAT pLKO_005 1604 CDS 100% 4.050 2.835 N CHRM2 n/a
10 TRCN0000011255 GCTGACCTTATCATAGGTGTT pLKO.1 651 CDS 100% 4.050 2.835 N CHRM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001006626.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00304 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00304 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468539 ACAGCACGTGTAGCGCAGTGAGGG pLX_317 28.4% 100% 100% V5 n/a
4 TRCN0000492171 GCCTTCATTTAGCGTCAGACGATG pLX_317 30.2% 100% 100% V5 (not translated due to prior stop codon) n/a
5 TRCN0000492120 CCAATGTGTACTTTACACTCATTA pLX_317 26.2% 99.9% 99.7% V5 1398_1399insG n/a
Download CSV