Transcript: Human NM_001010931.3

Homo sapiens hepatocyte growth factor (HGF), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
HGF (3082)
Length:
1200
CDS:
77..949

Additional Resources:

NCBI RefSeq record:
NM_001010931.3
NBCI Gene record:
HGF (3082)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001010931.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434210 TCGAGGTCTCATGGATCATAC pLKO_005 733 CDS 100% 10.800 15.120 N HGF n/a
2 TRCN0000003308 GCAAAGACTACCCTAATCAAA pLKO.1 212 CDS 100% 5.625 7.875 N HGF n/a
3 TRCN0000047137 GCAAAGACTACCCTAATCAAA pLKO.1 212 CDS 100% 5.625 7.875 N HGF n/a
4 TRCN0000003307 CAGACCAATGTGCTAATAGAT pLKO.1 276 CDS 100% 5.625 3.938 N HGF n/a
5 TRCN0000047135 CAGACCAATGTGCTAATAGAT pLKO.1 276 CDS 100% 5.625 3.938 N HGF n/a
6 TRCN0000031282 CCCTGGTGTTTCACAAGCAAT pLKO.1 635 CDS 100% 4.950 3.465 N Hgf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001010931.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15441 pDONR223 0% 98.2% 98.2% None 481_495del n/a
2 ccsbBroad304_15441 pLX_304 0% 98.2% 98.2% V5 481_495del n/a
3 TRCN0000474052 ACATACCTGGAATATGGGTGGTCG pLX_317 36.5% 98.2% 98.2% V5 481_495del n/a
4 ccsbBroadEn_06362 pDONR223 100% 72% 71.7% None (many diffs) n/a
5 ccsbBroad304_06362 pLX_304 0% 72% 71.7% V5 (many diffs) n/a
6 TRCN0000465581 GAGGAACTTTTGAAGCTGCAGCAA pLX_317 33.8% 72% 71.7% V5 (many diffs) n/a
7 TRCN0000476979 GGAATTTGTCACGGTGGCAGCATC pLX_317 19.7% 39.6% 39.2% V5 (many diffs) n/a
Download CSV