Transcript: Human NM_001011550.1

Homo sapiens MAGE family member A4 (MAGEA4), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
MAGEA4 (4103)
Length:
1712
CDS:
207..1160

Additional Resources:

NCBI RefSeq record:
NM_001011550.1
NBCI Gene record:
MAGEA4 (4103)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001011550.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143101 CAGTAACAAGGTGGATGAGTT pLKO.1 536 CDS 100% 4.950 3.465 N MAGEA4 n/a
2 TRCN0000139462 CGAGTCCCTGAAGATGATCTT pLKO.1 674 CDS 100% 4.950 3.465 N MAGEA4 n/a
3 TRCN0000122705 CCTGGGCACAATTGCAATGGA pLKO.1 824 CDS 100% 3.000 2.100 N MAGEA4 n/a
4 TRCN0000143152 CCTGAAGATGATCTTTGGCAT pLKO.1 680 CDS 100% 2.640 1.848 N MAGEA4 n/a
5 TRCN0000122385 GCAGCTTTGTTAGAGGAGGAA pLKO.1 1128 CDS 100% 2.640 1.848 N MAGEA4 n/a
6 TRCN0000122625 GCTGGTCACAAAGGCAGAAAT pLKO.1 593 CDS 100% 13.200 7.920 N MAGEA4 n/a
7 TRCN0000139488 CTGCGTGAAGCAGCTTTGTTA pLKO.1 1119 CDS 100% 5.625 3.375 N MAGEA4 n/a
8 TRCN0000143572 GCTGAAACCAGCTATGTGAAA pLKO.1 1044 CDS 100% 4.950 2.475 Y MAGEA4 n/a
9 TRCN0000139290 CAAAGGCAGAAATGCTGGAGA pLKO.1 601 CDS 100% 2.640 1.320 Y MAGEA4 n/a
10 TRCN0000143072 GTCAATGCAAGAGTTCGCATT pLKO.1 1086 CDS 100% 0.405 0.203 Y MAGEA4 n/a
11 TRCN0000161306 GTCAATGCAAGAGTTCGCATT pLKO.1 1086 CDS 100% 0.405 0.203 Y MAGEA8 n/a
12 TRCN0000141457 CAGCTATGTGAAAGTCCTGCA pLKO.1 1052 CDS 100% 2.160 1.080 Y MAGEA12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011550.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06552 pDONR223 100% 99.8% 99.6% None 517G>A n/a
2 ccsbBroad304_06552 pLX_304 0% 99.8% 99.6% V5 517G>A n/a
3 TRCN0000472116 CAAACACCCAATCCGTACCTTTCC pLX_317 36.8% 99.8% 99.6% V5 517G>A n/a
4 ccsbBroadEn_06551 pDONR223 100% 85.1% 75% None (many diffs) n/a
5 ccsbBroad304_06551 pLX_304 0% 85.1% 75% V5 (many diffs) n/a
6 TRCN0000480348 CATGATCCTTACGCAAACTTAGCG pLX_317 45.8% 85.1% 75% V5 (many diffs) n/a
7 ccsbBroadEn_00967 pDONR223 100% 34.5% 30.5% None (many diffs) n/a
8 ccsbBroad304_00967 pLX_304 0% 34.5% 30.5% V5 (many diffs) n/a
9 TRCN0000474004 TTCCCTTAAAATCATCCATACATA pLX_317 58.4% 34.5% 30.5% V5 (many diffs) n/a
Download CSV