Transcript: Human NM_001014291.4

Homo sapiens small proline rich protein 2G (SPRR2G), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
SPRR2G (6706)
Length:
589
CDS:
61..282

Additional Resources:

NCBI RefSeq record:
NM_001014291.4
NBCI Gene record:
SPRR2G (6706)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001014291.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254866 AGATCCAGTGGCTCTTCTTAC pLKO_005 317 3UTR 100% 10.800 7.560 N SPRR2G n/a
2 TRCN0000254868 TCCTTGTCCACCTGAGCATTG pLKO_005 177 CDS 100% 6.000 4.200 N SPRR2G n/a
3 TRCN0000254865 GAGCAAGTAACATCACTAGAA pLKO_005 273 CDS 100% 4.950 3.465 N SPRR2G n/a
4 TRCN0000180577 GAAGTATCCACCCAAGAGCAA pLKO.1 258 CDS 100% 2.640 1.848 N SPRR2G n/a
5 TRCN0000254867 TGCCCTCCTGTGCAACCATAC pLKO_005 223 CDS 100% 2.000 1.400 N SPRR2G n/a
6 TRCN0000254864 ACCTCCACCATGCCAGGATAA pLKO_005 201 CDS 100% 10.800 6.480 N SPRR2G n/a
7 TRCN0000180578 GTATCCACCCAAGAGCAAGTA pLKO.1 261 CDS 100% 4.950 2.970 N SPRR2G n/a
8 TRCN0000180634 CAACAAGATCCAGTGGCTCTT pLKO.1 312 3UTR 100% 4.050 2.430 N SPRR2G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001014291.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06991 pDONR223 100% 85.3% 82.1% None (many diffs) n/a
2 ccsbBroad304_06991 pLX_304 0% 85.3% 82.1% V5 (many diffs) n/a
3 TRCN0000467715 TCCTGGGTCCGAGCTCTAAATTCC pLX_317 100% 85.3% 82.1% V5 (many diffs) n/a
Download CSV