Transcript: Human NM_001017526.1

Homo sapiens Rho GTPase activating protein 8 (ARHGAP8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
ARHGAP8 (23779)
Length:
1725
CDS:
142..1536

Additional Resources:

NCBI RefSeq record:
NM_001017526.1
NBCI Gene record:
ARHGAP8 (23779)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243370 GTTGCGAACACTCTGTATATT pLKO_005 1538 3UTR 100% 15.000 7.500 Y ARHGAP8 n/a
2 TRCN0000243369 ATACGTTGAGAACGATTATAC pLKO_005 333 CDS 100% 13.200 6.600 Y ARHGAP8 n/a
3 TRCN0000123103 CGATTATACCATCGTCTATTT pLKO.1 345 CDS 100% 13.200 6.600 Y PRR5-ARHGAP8 n/a
4 TRCN0000257012 GAGCTCCACGAACACCTTAAA pLKO_005 664 CDS 100% 13.200 6.600 Y ARHGAP8 n/a
5 TRCN0000123101 TGTTGCGAACACTCTGTATAT pLKO.1 1537 CDS 100% 13.200 6.600 Y PRR5-ARHGAP8 n/a
6 TRCN0000243372 CCCTCATCAGTCACAAGTTTG pLKO_005 611 CDS 100% 10.800 5.400 Y ARHGAP8 n/a
7 TRCN0000243371 TTTGGCGTCAGTCTGCAATAC pLKO_005 811 CDS 100% 10.800 5.400 Y ARHGAP8 n/a
8 TRCN0000123100 CGGGAGAGCATCTTCAACAAA pLKO.1 1222 CDS 100% 5.625 2.813 Y PRR5-ARHGAP8 n/a
9 TRCN0000123102 GCGCATACAAGGAGTTCGATA pLKO.1 416 CDS 100% 4.950 2.475 Y PRR5-ARHGAP8 n/a
10 TRCN0000123099 CACTCTGTATATTTCGAGCTA pLKO.1 1546 3UTR 100% 2.640 1.320 Y PRR5-ARHGAP8 n/a
11 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 510 CDS 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017526.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07932 pDONR223 100% 93% 93.1% None (many diffs) n/a
2 ccsbBroad304_07932 pLX_304 0% 93% 93.1% V5 (many diffs) n/a
3 TRCN0000480002 TGCTCAGTAATGGCGAGCAGCACT pLX_317 26.3% 93% 93.1% V5 (many diffs) n/a
4 ccsbBroadEn_13712 pDONR223 100% 86.5% 86.6% None 0_1ins108;132A>G;300_392del n/a
5 ccsbBroad304_13712 pLX_304 0% 86.5% 86.6% V5 0_1ins108;132A>G;300_392del n/a
6 TRCN0000465392 AATTCTTTGTGAAACAGAGTACAT pLX_317 25% 86.5% 86.6% V5 0_1ins108;132A>G;300_392del n/a
Download CSV